EMAIL THIS PAGE TO A FRIEND

E2F2

E2F transcription factor 2

32 Gene Product Result for
Synonyms: E2F-2
UniProtKB ID: Q14209, B2R9W1, Q7Z6H1
Gene ID:
Human(1870) Summary: The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]
Mouse(242705) E2F transcription factor 2
Rat(684111) E2F transcription factor 2
Domestic Rabbit(100346379) E2F transcription factor 2
naked mole-rat(101711793) E2F transcription factor 2
domestic guinea pig(100714679) E2F transcription factor 2
fruit fly(35381) E2F transcription factor 2
cow(617024) E2F transcription factor 2
Horse(100057866) E2F transcription factor 2
domestic cat(101098067) E2F transcription factor 2
dog(100684439) E2F transcription factor 2
chicken(425366) E2F transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004091 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004091 Rosetta Predictions human pricing
NM_177733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030489 predicted 2120
2 SASI_Hs01_00030490 predicted 797
3 SASI_Hs01_00030491 predicted 1693
4 SASI_Hs01_00030492 predicted 539
5 SASI_Hs01_00030494 predicted 536
6 SASI_Hs01_00030495 predicted 903
7 SASI_Hs01_00030496 predicted 1087
8 SASI_Hs01_00030497 predicted 1151
9 SASI_Hs01_00030498 predicted 642
10 SASI_Hs02_00336895 predicted 1106
11 SASI_Hs01_00030493 predicted 1970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099754 predicted 1883
2 SASI_Mm01_00099755 predicted 1251
3 SASI_Mm01_00099756 predicted 1397
4 SASI_Mm01_00099757 predicted 514
5 SASI_Mm01_00099758 predicted 1050
6 SASI_Mm01_00099759 predicted 1239
7 SASI_Mm01_00099760 predicted 796
8 SASI_Mm01_00099761 predicted 515
9 SASI_Mm01_00099762 predicted 1072
10 SASI_Mm01_00099763 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177733
E2F2 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177733.6-1058s21c1
Sequence:CCGGAGACCTTGGACCAGCTCATTCCTCGAGGAATGAGCTGGTCCAAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177733.6-1673s21c1
Sequence:CCGGGTGACCTCTTCGACTCCTATGCTCGAGCATAGGAGTCGAAGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177733.2-2086s1c1
Sequence:CCGGGCAGGGAGATTTGTTCTAGTTCTCGAGAACTAGAACAAATCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-519s1c1
Sequence:CCGGCCACCTACTACACTTCGCTTTCTCGAGAAAGCGAAGTGTAGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-1421s1c1
Sequence:CCGGGAGACCATAGAGCCTTCAGTACTCGAGTACTGAAGGCTCTATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-1110s1c1
Sequence:CCGGCCGAAGATAATGCCAACAAGACTCGAGTCTTGTTGGCATTATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-799s1c1
Sequence:CCGGGCTCCTGACCAAGAAGTTCATCTCGAGATGAACTTCTTGGTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177733
E2F2 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177733.6-1058s21c1
Sequence:CCGGAGACCTTGGACCAGCTCATTCCTCGAGGAATGAGCTGGTCCAAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177733.6-1673s21c1
Sequence:CCGGGTGACCTCTTCGACTCCTATGCTCGAGCATAGGAGTCGAAGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177733.2-2086s1c1
Sequence:CCGGGCAGGGAGATTTGTTCTAGTTCTCGAGAACTAGAACAAATCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-519s1c1
Sequence:CCGGCCACCTACTACACTTCGCTTTCTCGAGAAAGCGAAGTGTAGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-1421s1c1
Sequence:CCGGGAGACCATAGAGCCTTCAGTACTCGAGTACTGAAGGCTCTATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-1110s1c1
Sequence:CCGGCCGAAGATAATGCCAACAAGACTCGAGTCTTGTTGGCATTATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-799s1c1
Sequence:CCGGGCTCCTGACCAAGAAGTTCATCTCGAGATGAACTTCTTGGTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177733
E2F2 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177733.6-1058s21c1
Sequence:CCGGAGACCTTGGACCAGCTCATTCCTCGAGGAATGAGCTGGTCCAAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177733.6-1673s21c1
Sequence:CCGGGTGACCTCTTCGACTCCTATGCTCGAGCATAGGAGTCGAAGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177733.2-2086s1c1
Sequence:CCGGGCAGGGAGATTTGTTCTAGTTCTCGAGAACTAGAACAAATCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-519s1c1
Sequence:CCGGCCACCTACTACACTTCGCTTTCTCGAGAAAGCGAAGTGTAGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-1421s1c1
Sequence:CCGGGAGACCATAGAGCCTTCAGTACTCGAGTACTGAAGGCTCTATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-1110s1c1
Sequence:CCGGCCGAAGATAATGCCAACAAGACTCGAGTCTTGTTGGCATTATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177733.2-799s1c1
Sequence:CCGGGCTCCTGACCAAGAAGTTCATCTCGAGATGAACTTCTTGGTCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004091
E2F2 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004091.2-1278s21c1
Sequence:CCGGGAGGACAACCTGCAGATATATCTCGAGATATATCTGCAGGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004091.2-1192s21c1
Sequence:CCGGTCCGTGCTGTTGGCAACTTTACTCGAGTAAAGTTGCCAACAGCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004091.2-3497s1c1
Sequence:CCGGCCACTCTATAAGCAGGGCTAACTCGAGTTAGCCCTGCTTATAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-637s1c1
Sequence:CCGGCCGAGGGCCAAGTTGTGCGATCTCGAGATCGCACAACTTGGCCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1694s1c1
Sequence:CCGGCAGCGATCTCTTCGACTCCTACTCGAGTAGGAGTCGAAGAGATCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1217s1c1
Sequence:CCGGGCAGACAGTGATTGCCGTCAACTCGAGTTGACGGCAATCACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1170s1c1
Sequence:CCGGGCCTATGTGACTTACCAGGATCTCGAGATCCTGGTAAGTCACATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004091
E2F2 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004091.2-1278s21c1
Sequence:CCGGGAGGACAACCTGCAGATATATCTCGAGATATATCTGCAGGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004091.2-1192s21c1
Sequence:CCGGTCCGTGCTGTTGGCAACTTTACTCGAGTAAAGTTGCCAACAGCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004091.2-3497s1c1
Sequence:CCGGCCACTCTATAAGCAGGGCTAACTCGAGTTAGCCCTGCTTATAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-637s1c1
Sequence:CCGGCCGAGGGCCAAGTTGTGCGATCTCGAGATCGCACAACTTGGCCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1694s1c1
Sequence:CCGGCAGCGATCTCTTCGACTCCTACTCGAGTAGGAGTCGAAGAGATCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1217s1c1
Sequence:CCGGGCAGACAGTGATTGCCGTCAACTCGAGTTGACGGCAATCACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1170s1c1
Sequence:CCGGGCCTATGTGACTTACCAGGATCTCGAGATCCTGGTAAGTCACATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004091
E2F2 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004091.2-1278s21c1
Sequence:CCGGGAGGACAACCTGCAGATATATCTCGAGATATATCTGCAGGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004091.2-1192s21c1
Sequence:CCGGTCCGTGCTGTTGGCAACTTTACTCGAGTAAAGTTGCCAACAGCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004091.2-3497s1c1
Sequence:CCGGCCACTCTATAAGCAGGGCTAACTCGAGTTAGCCCTGCTTATAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-637s1c1
Sequence:CCGGCCGAGGGCCAAGTTGTGCGATCTCGAGATCGCACAACTTGGCCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1694s1c1
Sequence:CCGGCAGCGATCTCTTCGACTCCTACTCGAGTAGGAGTCGAAGAGATCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1217s1c1
Sequence:CCGGGCAGACAGTGATTGCCGTCAACTCGAGTTGACGGCAATCACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004091.2-1170s1c1
Sequence:CCGGGCCTATGTGACTTACCAGGATCTCGAGATCCTGGTAAGTCACATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks