EMAIL THIS PAGE TO A FRIEND

E2F3

E2F transcription factor 3

301 Gene Product Result for
Synonyms: E2F-3
UniProtKB ID: O00716, Q15000, Q68DT0, Q9BZ44
Gene ID:
Human(1871) Summary: This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(13557) E2F transcription factor 3
Rat(291105) E2F transcription factor 3
Thale Cress(818174) E2F transcription factor 3
chicken(420824) E2F transcription factor 3
cow(541184) E2F transcription factor 3
domestic cat(101089768) E2F transcription factor 3
dog(488239) E2F transcription factor 3
domestic guinea pig(100722981) E2F transcription factor 3
naked mole-rat(101698963) E2F transcription factor 3
sheep(101121809) E2F transcription factor 3
Domestic Rabbit(100353173) E2F transcription factor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001949 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001949 Rosetta Predictions human pricing
XM_214476 Rosetta Predictions rat pricing
XR_008490 Rosetta Predictions rat pricing
NM_010093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036016 predicted 1217
2 SASI_Hs01_00036017 predicted 1244
3 SASI_Hs02_00332869 predicted 1390
4 SASI_Hs01_00036018 predicted 1200
5 SASI_Hs01_00036019 predicted 1326
6 SASI_Hs02_00332870 predicted 1439
7 SASI_Hs01_00036020 predicted 1250
8 SASI_Hs02_00332871 predicted 1561
9 SASI_Hs01_00036021 predicted 1322
10 SASI_Hs01_00036025 predicted 1197
11 SASI_Hs01_00036022 predicted 1132
12 SASI_Hs01_00036023 predicted 1135
13 SASI_Hs01_00036024 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375315 predicted 714
2 SASI_Rn02_00375316 predicted 626
3 SASI_Rn02_00375317 predicted 622
4 SASI_Rn02_00375318 predicted 720
5 SASI_Rn02_00375319 predicted 719
6 SASI_Rn02_00375320 predicted 687
7 SASI_Rn02_00375321 predicted 634
8 SASI_Rn02_00375322 predicted 708
9 SASI_Rn02_00375323 predicted 717
10 SASI_Rn02_00375324 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417175 predicted 492
2 SASI_Rn02_00417176 predicted 1833
3 SASI_Rn01_00166102 predicted 481
4 SASI_Rn02_00417177 predicted 1739
5 SASI_Rn02_00417178 predicted 1741
6 SASI_Rn02_00417179 predicted 464
7 SASI_Rn02_00417180 predicted 252
8 SASI_Rn02_00417181 predicted 412
9 SASI_Rn02_00417182 predicted 461
10 SASI_Rn02_00417183 predicted 258
11 SASI_Rn01_00166097 predicted 1416
12 SASI_Rn01_00166098 predicted 1517
13 SASI_Rn01_00166099 predicted 1682
14 SASI_Rn01_00166100 predicted 1517
15 SASI_Rn01_00166101 predicted 1390
16 SASI_Rn01_00166103 predicted 2331
17 SASI_Rn01_00166104 predicted 2352
18 SASI_Rn01_00166105 predicted 2423
19 SASI_Rn01_00166106 predicted 2395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021319 predicted 1267
2 SASI_Mm01_00021320 predicted 1538
3 SASI_Mm02_00317785 predicted 1288
4 SASI_Mm02_00317786 predicted 2215
5 SASI_Mm01_00021323 predicted 1243
6 SASI_Mm02_00317787 predicted 1341
7 SASI_Mm02_00317788 predicted 1050
8 SASI_Mm02_00317789 predicted 1523
9 SASI_Mm02_00317790 predicted 1245
10 SASI_Mm01_00021328 predicted 1251
11 SASI_Mm01_00021321 predicted 1209
12 SASI_Mm01_00021322 predicted 998
13 SASI_Mm01_00021324 predicted 1241
14 SASI_Mm01_00021325 predicted 813
15 SASI_Mm01_00021326 predicted 1262
16 SASI_Mm01_00021327 predicted 1193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001949
VALIDATED
E2F3 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-2879s1c1
Sequence:CCGGCCCGCTTTACTCTTCAGGAATCTCGAGATTCCTGAAGAGTAAAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1002s1c1
Sequence:CCGGCCAAACTGTTATAGTTGTGAACTCGAGTTCACAACTATAACAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1051s1c1
Sequence:CCGGCCTGACTCAATAGAGAGCCTACTCGAGTAGGCTCTCTATTGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1214s1c1
Sequence:CCGGCCAACTCAGGACATAGCGATTCTCGAGAATCGCTATGTCCTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-753s1c1
Sequence:CCGGCCTCATTAAGAAGAAGTCTAACTCGAGTTAGACTTCTTCTTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001949.3-2165s21c1
Sequence:CCGGGTCTTTGAGGTCTGCTAATATCTCGAGATATTAGCAGACCTCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-856s21c1
Sequence:CCGGACGCGGTATGATACGTCTCTTCTCGAGAAGAGACGTATCATACCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-503s21c1
Sequence:CCGGAGATCCTCACCACGAACACTTCTCGAGAAGTGTTCGTGGTGAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-1708s21c1
Sequence:CCGGGACTTCATGTGTAGTTGATTACTCGAGTAATCAACTACACATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-810s21c1
Sequence:CCGGACGAAGTCCAGATAGTCCAAACTCGAGTTTGGACTATCTGGACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-1574s21c1
Sequence:CCGGCCAACCTAGAAGGACCGTTTGCTCGAGCAAACGGTCCTTCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001949
VALIDATED
E2F3 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-2879s1c1
Sequence:CCGGCCCGCTTTACTCTTCAGGAATCTCGAGATTCCTGAAGAGTAAAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1002s1c1
Sequence:CCGGCCAAACTGTTATAGTTGTGAACTCGAGTTCACAACTATAACAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1051s1c1
Sequence:CCGGCCTGACTCAATAGAGAGCCTACTCGAGTAGGCTCTCTATTGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1214s1c1
Sequence:CCGGCCAACTCAGGACATAGCGATTCTCGAGAATCGCTATGTCCTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-753s1c1
Sequence:CCGGCCTCATTAAGAAGAAGTCTAACTCGAGTTAGACTTCTTCTTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001949.3-2165s21c1
Sequence:CCGGGTCTTTGAGGTCTGCTAATATCTCGAGATATTAGCAGACCTCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-856s21c1
Sequence:CCGGACGCGGTATGATACGTCTCTTCTCGAGAAGAGACGTATCATACCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-503s21c1
Sequence:CCGGAGATCCTCACCACGAACACTTCTCGAGAAGTGTTCGTGGTGAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-1708s21c1
Sequence:CCGGGACTTCATGTGTAGTTGATTACTCGAGTAATCAACTACACATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-810s21c1
Sequence:CCGGACGAAGTCCAGATAGTCCAAACTCGAGTTTGGACTATCTGGACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-1574s21c1
Sequence:CCGGCCAACCTAGAAGGACCGTTTGCTCGAGCAAACGGTCCTTCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001949
VALIDATED
E2F3 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-2879s1c1
Sequence:CCGGCCCGCTTTACTCTTCAGGAATCTCGAGATTCCTGAAGAGTAAAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1002s1c1
Sequence:CCGGCCAAACTGTTATAGTTGTGAACTCGAGTTCACAACTATAACAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1051s1c1
Sequence:CCGGCCTGACTCAATAGAGAGCCTACTCGAGTAGGCTCTCTATTGAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-1214s1c1
Sequence:CCGGCCAACTCAGGACATAGCGATTCTCGAGAATCGCTATGTCCTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001949.2-753s1c1
Sequence:CCGGCCTCATTAAGAAGAAGTCTAACTCGAGTTAGACTTCTTCTTAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001949.3-2165s21c1
Sequence:CCGGGTCTTTGAGGTCTGCTAATATCTCGAGATATTAGCAGACCTCAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-856s21c1
Sequence:CCGGACGCGGTATGATACGTCTCTTCTCGAGAAGAGACGTATCATACCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-503s21c1
Sequence:CCGGAGATCCTCACCACGAACACTTCTCGAGAAGTGTTCGTGGTGAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-1708s21c1
Sequence:CCGGGACTTCATGTGTAGTTGATTACTCGAGTAATCAACTACACATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-810s21c1
Sequence:CCGGACGAAGTCCAGATAGTCCAAACTCGAGTTTGGACTATCTGGACTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001949.3-1574s21c1
Sequence:CCGGCCAACCTAGAAGGACCGTTTGCTCGAGCAAACGGTCCTTCTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010093
E2F3 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010093.3-4018s21c1
Sequence:CCGGCGTATTGTGATGCCGTATTTACTCGAGTAAATACGGCATCACAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-803s21c1
Sequence:CCGGGTACCTCTCAGATGGTCTAAACTCGAGTTTAGACCATCTGAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1245s21c1
Sequence:CCGGGAGAATCAAAGGTTAGCTTATCTCGAGATAAGCTAACCTTTGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1361s21c1
Sequence:CCGGCTCAATAGAGAGCCTACAAATCTCGAGATTTGTAGGCTCTCTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1398s21c1
Sequence:CCGGCAAGGGCCCATTGAGGTTTACCTCGAGGTAAACCTCAATGGGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010093
E2F3 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010093.3-4018s21c1
Sequence:CCGGCGTATTGTGATGCCGTATTTACTCGAGTAAATACGGCATCACAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-803s21c1
Sequence:CCGGGTACCTCTCAGATGGTCTAAACTCGAGTTTAGACCATCTGAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1245s21c1
Sequence:CCGGGAGAATCAAAGGTTAGCTTATCTCGAGATAAGCTAACCTTTGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1361s21c1
Sequence:CCGGCTCAATAGAGAGCCTACAAATCTCGAGATTTGTAGGCTCTCTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1398s21c1
Sequence:CCGGCAAGGGCCCATTGAGGTTTACCTCGAGGTAAACCTCAATGGGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010093
E2F3 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010093.3-4018s21c1
Sequence:CCGGCGTATTGTGATGCCGTATTTACTCGAGTAAATACGGCATCACAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-803s21c1
Sequence:CCGGGTACCTCTCAGATGGTCTAAACTCGAGTTTAGACCATCTGAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1245s21c1
Sequence:CCGGGAGAATCAAAGGTTAGCTTATCTCGAGATAAGCTAACCTTTGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1361s21c1
Sequence:CCGGCTCAATAGAGAGCCTACAAATCTCGAGATTTGTAGGCTCTCTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010093.3-1398s21c1
Sequence:CCGGCAAGGGCCCATTGAGGTTTACCTCGAGGTAAACCTCAATGGGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks