EMAIL THIS PAGE TO A FRIEND

E2F4

E2F transcription factor 4, p107/p130-binding

54 Gene Product Result for
Synonyms: E2F-4
UniProtKB ID: Q16254, A6NGR8, B5BU56, Q12991, Q15328
Gene ID:
Human(1874) Summary: The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
Mouse(104394) E2F transcription factor 4
Rat(100360427) E2F transcription factor 4, p107/p130-binding
Zebrafish(406741) E2F transcription factor 4
chicken(769430) E2F transcription factor 4, p107/p130-binding
dog(611243) E2F transcription factor 4, p107/p130-binding
cow(525428) E2F transcription factor 4, p107/p130-binding
domestic cat(101098911) E2F transcription factor 4, p107/p130-binding
sheep(101106963) E2F transcription factor 4, p107/p130-binding
naked mole-rat(101716696) E2F transcription factor 4, p107/p130-binding
domestic guinea pig(100735380) E2F transcription factor 4, p107/p130-binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31175 Anti-E2F4 antibody produced in rabbit affinity isolated antibody rat, zebrafish, human, bovine, mouse, canine
immunohistochemistry, western blot pricing
SAB4500685 Anti-E2F4 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1410315 Anti-E2F4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
HPA054128 Anti-E2F4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0001874M1 Monoclonal Anti-E2F4 antibody produced in mouse clone 5B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
E8526 Monoclonal Anti-E2F4 antibody produced in mouse ~0.5 mg/mL, clone WUF3, purified immunoglobulin, buffered aqueous solution human
immunoprecipitation, microarray, western blot pricing
PLA0241 Rabbit anti-E2F4 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chicken, bovine, rhesus monkey, turkey, rabbit, primate, dog, mouse, human, guinea pig, horse, pig
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001950 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001950 Rosetta Predictions human pricing
NM_148952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131988 predicted 1787
2 SASI_Hs01_00131989 predicted 1264
3 SASI_Hs01_00131990 predicted 709
4 SASI_Hs01_00131991 predicted 1256
5 SASI_Hs01_00131992 predicted 1701
6 SASI_Hs01_00131993 predicted 1273
7 SASI_Hs02_00332872 predicted 567
8 SASI_Hs01_00131996 predicted 1284
9 SASI_Hs01_00131997 predicted 689
10 SASI_Hs02_00332873 predicted 1787
11 SASI_Hs01_00131994 predicted 612
12 SASI_Hs01_00131995 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149831 predicted 227
2 SASI_Mm01_00149832 predicted 723
3 SASI_Mm01_00149833 predicted 635
4 SASI_Mm01_00149834 predicted 1741
5 SASI_Mm01_00149835 predicted 1702
6 SASI_Mm02_00342780 predicted 599
7 SASI_Mm01_00149836 predicted 197
8 SASI_Mm01_00149837 predicted 1751
9 SASI_Mm01_00149838 predicted 526
10 SASI_Mm01_00149840 predicted 345
11 SASI_Mm01_00149839 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148952
VALIDATED
E2F4 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 4, p107/p130-binding
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-353s21c1
Sequence:CCGGAGATCGCTGACAAGCTGATTGCTCGAGCAATCAGCTTGTCAGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-279s21c1
Sequence:CCGGCATCGGTCTGATCGAGAAGAACTCGAGTTCTTCTCGATCAGACCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-303s21c1
Sequence:CCGGCAAGAACAGCATCCAGTGGAACTCGAGTTCCACTGGATGCTGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-1631s21c1
Sequence:CCGGGCCTACCATCACCTTTCCTTTCTCGAGAAAGGAAAGGTGATGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-608s21c1
Sequence:CCGGAGAAGTACCAGATTCACTTAACTCGAGTTAAGTGAATCTGGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1631s1c1
Sequence:CCGGGCCTACCATCACCTTTCCTTTCTCGAGAAAGGAAAGGTGATGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1174s1c1
Sequence:CCGGGAAGAACTGATGTCTTCAGAACTCGAGTTCTGAAGACATCAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1236s1c1
Sequence:CCGGCCACGATTACATCTACAACCTCTCGAGAGGTTGTAGATGTAATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148952.1-303s1c1
Sequence:CCGGCAAGAACAGCATCCAGTGGAACTCGAGTTCCACTGGATGCTGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148952
VALIDATED
E2F4 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 4, p107/p130-binding
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-353s21c1
Sequence:CCGGAGATCGCTGACAAGCTGATTGCTCGAGCAATCAGCTTGTCAGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-279s21c1
Sequence:CCGGCATCGGTCTGATCGAGAAGAACTCGAGTTCTTCTCGATCAGACCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-303s21c1
Sequence:CCGGCAAGAACAGCATCCAGTGGAACTCGAGTTCCACTGGATGCTGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-1631s21c1
Sequence:CCGGGCCTACCATCACCTTTCCTTTCTCGAGAAAGGAAAGGTGATGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-608s21c1
Sequence:CCGGAGAAGTACCAGATTCACTTAACTCGAGTTAAGTGAATCTGGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1631s1c1
Sequence:CCGGGCCTACCATCACCTTTCCTTTCTCGAGAAAGGAAAGGTGATGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1174s1c1
Sequence:CCGGGAAGAACTGATGTCTTCAGAACTCGAGTTCTGAAGACATCAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1236s1c1
Sequence:CCGGCCACGATTACATCTACAACCTCTCGAGAGGTTGTAGATGTAATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148952.1-303s1c1
Sequence:CCGGCAAGAACAGCATCCAGTGGAACTCGAGTTCCACTGGATGCTGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148952
VALIDATED
E2F4 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 4, p107/p130-binding
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-353s21c1
Sequence:CCGGAGATCGCTGACAAGCTGATTGCTCGAGCAATCAGCTTGTCAGCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-279s21c1
Sequence:CCGGCATCGGTCTGATCGAGAAGAACTCGAGTTCTTCTCGATCAGACCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-303s21c1
Sequence:CCGGCAAGAACAGCATCCAGTGGAACTCGAGTTCCACTGGATGCTGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-1631s21c1
Sequence:CCGGGCCTACCATCACCTTTCCTTTCTCGAGAAAGGAAAGGTGATGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148952.1-608s21c1
Sequence:CCGGAGAAGTACCAGATTCACTTAACTCGAGTTAAGTGAATCTGGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1631s1c1
Sequence:CCGGGCCTACCATCACCTTTCCTTTCTCGAGAAAGGAAAGGTGATGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1174s1c1
Sequence:CCGGGAAGAACTGATGTCTTCAGAACTCGAGTTCTGAAGACATCAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148952.1-1236s1c1
Sequence:CCGGCCACGATTACATCTACAACCTCTCGAGAGGTTGTAGATGTAATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148952.1-303s1c1
Sequence:CCGGCAAGAACAGCATCCAGTGGAACTCGAGTTCCACTGGATGCTGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001950
VALIDATED
E2F4 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 4, p107/p130-binding
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-396s21c1
Sequence:CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001950.3-1923s21c1
Sequence:CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-232s21c1
Sequence:CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-1273s21c1
Sequence:CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-1168s21c1
Sequence:CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1923s1c1
Sequence:CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1168s1c1
Sequence:CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-396s1c1
Sequence:CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-232s1c1
Sequence:CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1273s1c1
Sequence:CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001950
VALIDATED
E2F4 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 4, p107/p130-binding
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-396s21c1
Sequence:CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001950.3-1923s21c1
Sequence:CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-232s21c1
Sequence:CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-1273s21c1
Sequence:CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-1168s21c1
Sequence:CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1923s1c1
Sequence:CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1168s1c1
Sequence:CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-396s1c1
Sequence:CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-232s1c1
Sequence:CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1273s1c1
Sequence:CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001950
VALIDATED
E2F4 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 4, p107/p130-binding
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-396s21c1
Sequence:CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001950.3-1923s21c1
Sequence:CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-232s21c1
Sequence:CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-1273s21c1
Sequence:CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001950.3-1168s21c1
Sequence:CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013808    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1923s1c1
Sequence:CCGGCCCTCTCTTCATTTCGGCTTTCTCGAGAAAGCCGAAATGAAGAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1168s1c1
Sequence:CCGGGAGGAGTTGATGTCCTCAGAACTCGAGTTCTGAGGACATCAACTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-396s1c1
Sequence:CCGGGCAAGAACTAGACCAGCACAACTCGAGTTGTGCTGGTCTAGTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-232s1c1
Sequence:CCGGCGGATTTACGACATTACCAATCTCGAGATTGGTAATGTCGTAAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001950.3-1273s1c1
Sequence:CCGGGACCTCTTTGATGTGCCTGTTCTCGAGAACAGGCACATCAAAGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)