EMAIL THIS PAGE TO A FRIEND

E2F5

E2F transcription factor 5, p130-binding

161 Gene Product Result for
Synonyms: E2F-5
UniProtKB ID: Q15329, E9PBN9, Q16601, Q92756
Gene ID:
Human(1875) Summary: The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13559) E2F transcription factor 5
Rat(116651) E2F transcription factor 5
Zebrafish(402908) E2F transcription factor 5
dog(611103) E2F transcription factor 5, p130-binding
cow(539427) E2F transcription factor 5, p130-binding
domestic cat(101096875) E2F transcription factor 5, p130-binding
chicken(420206) E2F transcription factor 5, p130-binding
domestic guinea pig(100718912) E2F transcription factor 5, p130-binding
naked mole-rat(101701212) E2F transcription factor 5, p130-binding
sheep(101114117) E2F transcription factor 5, p130-binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007892 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007892 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007892 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083588 Rosetta Predictions human pricing
NM_001083589 Rosetta Predictions human pricing
NM_001951 Rosetta Predictions human pricing
XM_001053974 Rosetta Predictions rat pricing
XM_574892 Rosetta Predictions rat pricing
NM_007892 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316971 predicted 1191
2 SASI_Hs02_00316972 predicted 624
3 SASI_Hs02_00316973 predicted 1365
4 SASI_Hs02_00316974 predicted 1385
5 SASI_Hs02_00316975 predicted 1443
6 SASI_Hs02_00316976 predicted 1181
7 SASI_Hs02_00316977 predicted 603
8 SASI_Hs02_00316978 predicted 1398
9 SASI_Hs02_00316979 predicted 563
10 SASI_Hs02_00316980 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316981 predicted 1045
2 SASI_Hs02_00316982 predicted 481
3 SASI_Hs02_00316983 predicted 1220
4 SASI_Hs02_00316984 predicted 1238
5 SASI_Hs02_00316985 predicted 1293
6 SASI_Hs02_00316986 predicted 1037
7 SASI_Hs02_00316987 predicted 461
8 SASI_Hs02_00316988 predicted 1255
9 SASI_Hs02_00316989 predicted 418
10 SASI_Hs02_00316990 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332874 predicted 1195
2 SASI_Hs02_00332875 predicted 621
3 SASI_Hs02_00332876 predicted 1368
4 SASI_Hs02_00332877 predicted 1383
5 SASI_Hs02_00332878 predicted 1450
6 SASI_Hs02_00332879 predicted 1190
7 SASI_Hs02_00332880 predicted 606
8 SASI_Hs02_00332881 predicted 1402
9 SASI_Hs01_00109817 predicted 566
10 SASI_Hs02_00332882 predicted 1190
11 SASI_Hs01_00109812 predicted 903
12 SASI_Hs01_00109813 predicted 932
13 SASI_Hs01_00109814 predicted 887
14 SASI_Hs01_00109815 predicted 1096
15 SASI_Hs01_00109816 predicted 1046
16 SASI_Hs01_00109818 predicted 664
17 SASI_Hs01_00109819 predicted 921
18 SASI_Hs01_00109820 predicted 1044
19 SASI_Hs01_00109821 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274187 predicted 629
2 SASI_Rn02_00274188 predicted 1084
3 SASI_Rn02_00274189 predicted 826
4 SASI_Rn02_00274190 predicted 1133
5 SASI_Rn02_00274191 predicted 1034
6 SASI_Rn02_00274192 predicted 1103
7 SASI_Rn02_00274193 predicted 985
8 SASI_Rn02_00274194 predicted 949
9 SASI_Rn02_00274195 predicted 1087
10 SASI_Rn02_00274196 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402735 predicted 673
2 SASI_Rn02_00402736 predicted 795
3 SASI_Rn02_00402737 predicted 876
4 SASI_Rn02_00402738 predicted 787
5 SASI_Rn02_00402739 predicted 660
6 SASI_Rn02_00402740 predicted 985
7 SASI_Rn02_00402741 predicted 715
8 SASI_Rn02_00402742 predicted 948
9 SASI_Rn02_00402743 predicted 657
10 SASI_Rn02_00402744 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007892 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076931 predicted 652
2 SASI_Mm01_00076933 predicted 1114
3 SASI_Mm02_00312681 predicted 984
4 SASI_Mm01_00076934 predicted 1122
5 SASI_Mm01_00076936 predicted 660
6 SASI_Mm02_00312682 predicted 1124
7 SASI_Mm01_00076937 predicted 1111
8 SASI_Mm01_00076938 predicted 1163
9 SASI_Mm01_00076939 predicted 1085
10 SASI_Mm01_00076940 predicted 1156
11 SASI_Mm01_00076932 predicted 1173
12 SASI_Mm01_00076935 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007892
VALIDATED
E2F5 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 5, p130-binding
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007892.2-1433s1c1
Sequence:CCGGGCTCCAGTTCATCCAAACAAACTCGAGTTTGTTTGGATGAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-522s1c1
Sequence:CCGGGCTGAAATTGAAGATCTCGAACTCGAGTTCGAGATCTTCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-1076s1c1
Sequence:CCGGCCCAGCAGATGACTACAACTTCTCGAGAAGTTGTAGTCATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-786s1c1
Sequence:CCGGCCTATCCATGTGCTACTTATACTCGAGTATAAGTAGCACATGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-1125s1c1
Sequence:CCGGGATCTGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007892.2-1523s21c1
Sequence:CCGGAGACATTCACTGCCATATATACTCGAGTATATATGGCAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007892.2-992s21c1
Sequence:CCGGAGTATCTTCAGGATCTATTAGCTCGAGCTAATAGATCCTGAAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007892.2-787s21c1
Sequence:CCGGCTATCCATGTGCTACTTATAACTCGAGTTATAAGTAGCACATGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007892.2-525s21c1
Sequence:CCGGGAAATTGAAGATCTCGAATTGCTCGAGCAATTCGAGATCTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007892.2-467s21c1
Sequence:CCGGTGTAGGTGCTGGCTGTAATACCTCGAGGTATTACAGCCAGCACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007892
VALIDATED
E2F5 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 5, p130-binding
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007892.2-1433s1c1
Sequence:CCGGGCTCCAGTTCATCCAAACAAACTCGAGTTTGTTTGGATGAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-522s1c1
Sequence:CCGGGCTGAAATTGAAGATCTCGAACTCGAGTTCGAGATCTTCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-1076s1c1
Sequence:CCGGCCCAGCAGATGACTACAACTTCTCGAGAAGTTGTAGTCATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-786s1c1
Sequence:CCGGCCTATCCATGTGCTACTTATACTCGAGTATAAGTAGCACATGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-1125s1c1
Sequence:CCGGGATCTGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007892.2-1523s21c1
Sequence:CCGGAGACATTCACTGCCATATATACTCGAGTATATATGGCAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007892.2-992s21c1
Sequence:CCGGAGTATCTTCAGGATCTATTAGCTCGAGCTAATAGATCCTGAAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007892.2-787s21c1
Sequence:CCGGCTATCCATGTGCTACTTATAACTCGAGTTATAAGTAGCACATGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007892.2-525s21c1
Sequence:CCGGGAAATTGAAGATCTCGAATTGCTCGAGCAATTCGAGATCTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007892.2-467s21c1
Sequence:CCGGTGTAGGTGCTGGCTGTAATACCTCGAGGTATTACAGCCAGCACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007892
VALIDATED
E2F5 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 5, p130-binding
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007892.2-1433s1c1
Sequence:CCGGGCTCCAGTTCATCCAAACAAACTCGAGTTTGTTTGGATGAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-522s1c1
Sequence:CCGGGCTGAAATTGAAGATCTCGAACTCGAGTTCGAGATCTTCAATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-1076s1c1
Sequence:CCGGCCCAGCAGATGACTACAACTTCTCGAGAAGTTGTAGTCATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-786s1c1
Sequence:CCGGCCTATCCATGTGCTACTTATACTCGAGTATAAGTAGCACATGGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007892.2-1125s1c1
Sequence:CCGGGATCTGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007892.2-1523s21c1
Sequence:CCGGAGACATTCACTGCCATATATACTCGAGTATATATGGCAGTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007892.2-992s21c1
Sequence:CCGGAGTATCTTCAGGATCTATTAGCTCGAGCTAATAGATCCTGAAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007892.2-787s21c1
Sequence:CCGGCTATCCATGTGCTACTTATAACTCGAGTTATAAGTAGCACATGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007892.2-525s21c1
Sequence:CCGGGAAATTGAAGATCTCGAATTGCTCGAGCAATTCGAGATCTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007892.2-467s21c1
Sequence:CCGGTGTAGGTGCTGGCTGTAATACCTCGAGGTATTACAGCCAGCACCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001951
E2F5 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 5, p130-binding
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001951.2-1449s1c1
Sequence:CCGGGCCACTAAACTGCCTGTATTTCTCGAGAAATACAGGCAGTTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-889s1c1
Sequence:CCGGGCAGACATCAGCTACAGATATCTCGAGATATCTGTAGCTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-389s1c1
Sequence:CCGGGCTGGCTGTAATACTAAAGAACTCGAGTTCTTTAGTATTACAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-995s1c1
Sequence:CCGGCCGGCAGATGACTACAACTTTCTCGAGAAAGTTGTAGTCATCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001951.3-670s21c1
Sequence:CCGGGAAATACCAGATCAATCTAAACTCGAGTTTAGATTGATCTGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001951.3-927s21c1
Sequence:CCGGCTATTAGTGGAGATATCATTGCTCGAGCAATGATATCTCCACTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001951
E2F5 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 5, p130-binding
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001951.2-1449s1c1
Sequence:CCGGGCCACTAAACTGCCTGTATTTCTCGAGAAATACAGGCAGTTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-889s1c1
Sequence:CCGGGCAGACATCAGCTACAGATATCTCGAGATATCTGTAGCTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-389s1c1
Sequence:CCGGGCTGGCTGTAATACTAAAGAACTCGAGTTCTTTAGTATTACAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-995s1c1
Sequence:CCGGCCGGCAGATGACTACAACTTTCTCGAGAAAGTTGTAGTCATCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001951.3-670s21c1
Sequence:CCGGGAAATACCAGATCAATCTAAACTCGAGTTTAGATTGATCTGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001951.3-927s21c1
Sequence:CCGGCTATTAGTGGAGATATCATTGCTCGAGCAATGATATCTCCACTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001951
E2F5 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 5, p130-binding
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001951.2-1449s1c1
Sequence:CCGGGCCACTAAACTGCCTGTATTTCTCGAGAAATACAGGCAGTTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-889s1c1
Sequence:CCGGGCAGACATCAGCTACAGATATCTCGAGATATCTGTAGCTGATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-389s1c1
Sequence:CCGGGCTGGCTGTAATACTAAAGAACTCGAGTTCTTTAGTATTACAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001951.2-995s1c1
Sequence:CCGGCCGGCAGATGACTACAACTTTCTCGAGAAAGTTGTAGTCATCTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001951.3-670s21c1
Sequence:CCGGGAAATACCAGATCAATCTAAACTCGAGTTTAGATTGATCTGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001951.3-927s21c1
Sequence:CCGGCTATTAGTGGAGATATCATTGCTCGAGCAATGATATCTCCACTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks