EMAIL THIS PAGE TO A FRIEND

E2F6

E2F transcription factor 6

296 Gene Product Result for
Synonyms: E2F-6
UniProtKB ID: O75461, A8K2Z8, O60544, Q53QY9, Q7Z2H6
Gene ID:
Human(1876) Summary: This gene encodes a member of a family of transcription factors that play a crucial role in the control of the cell cycle. The protein encoded by this gene lacks the transactivation and tumor suppressor protein association domains found in other family members, and contains a modular suppression domain that functions in the inhibition of transcription. It interacts in a complex with chromatin modifying factors. There are pseudogenes for this gene on chromosomes 22 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(50496) E2F transcription factor 6
Rat(313978) E2F transcription factor 6
sheep(101120153) E2F transcription factor 6
naked mole-rat(101722781) E2F transcription factor 6
domestic guinea pig(100713523) E2F transcription factor 6
chicken(421943) E2F transcription factor 6
domestic cat(101094261) E2F transcription factor 6
cow(514085) E2F transcription factor 6
dog(609996) E2F transcription factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501448 Anti-E2F6 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, bovine, human
ELISA, western blot pricing
AV32221 Anti-E2F6 antibody produced in rabbit affinity isolated antibody human, horse, mouse, canine, rat, bovine, guinea pig
immunohistochemistry, western blot pricing
SAB4500686 Anti-E2F6 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1410316 Anti-E2F6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA065719 Anti-E2F6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
E8655 Anti-E6AP antibody, Mouse monoclonal clone E6AP-330, purified from hybridoma cell culture monkey, rat, mouse, human
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
WH0001876M1 Monoclonal Anti-E2F6 antibody produced in mouse clone 2B6-G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
E1532 Monoclonal Anti-E2F6 antibody produced in mouse ~1.0 mg/mL, clone TFE61, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, western blot pricing
SAB1403752 Monoclonal Anti-E2F6 antibody produced in mouse clone 1F7-A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001952 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001952 Rosetta Predictions human pricing
NM_198256 Rosetta Predictions human pricing
NM_198257 Rosetta Predictions human pricing
NM_198258 Rosetta Predictions human pricing
NM_198325 Rosetta Predictions human pricing
NM_212540 Rosetta Predictions human pricing
NR_003092 Rosetta Predictions human pricing
NR_003093 Rosetta Predictions human pricing
NR_003094 Rosetta Predictions human pricing
NR_003095 Rosetta Predictions human pricing
XM_001069459 Rosetta Predictions rat pricing
XM_001069501 Rosetta Predictions rat pricing
XM_233986 Rosetta Predictions rat pricing
NM_033270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060134 predicted 1136
2 SASI_Hs01_00060135 predicted 940
3 SASI_Hs01_00060136 predicted 835
4 SASI_Hs01_00060137 predicted 1139
5 SASI_Hs01_00060138 predicted 821
6 SASI_Hs01_00060139 predicted 975
7 SASI_Hs01_00060140 predicted 753
8 SASI_Hs01_00060141 predicted 1125
9 SASI_Hs01_00060142 predicted 942
10 SASI_Hs01_00060143 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371798 predicted 1136
2 SASI_Hs02_00371799 predicted 942
3 SASI_Hs01_00174470 predicted 823
4 SASI_Hs02_00371800 predicted 973
5 SASI_Hs02_00371801 predicted 725
6 SASI_Hs01_00174469 predicted 753
7 SASI_Hs02_00371802 predicted 1179
8 SASI_Hs02_00371803 predicted 1118
9 SASI_Hs02_00371804 predicted 851
10 SASI_Hs01_00174478 predicted 648
11 SASI_Hs01_00174471 predicted 657
12 SASI_Hs01_00174472 predicted 801
13 SASI_Hs01_00174473 predicted 908
14 SASI_Hs01_00174474 predicted 510
15 SASI_Hs01_00174475 predicted 460
16 SASI_Hs01_00174476 predicted 402
17 SASI_Hs01_00174477 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087250 predicted 886
2 SASI_Hs01_00087251 predicted 696
3 SASI_Hs01_00087252 predicted 767
4 SASI_Hs01_00087253 predicted 524
5 SASI_Hs01_00087254 predicted 669
6 SASI_Hs01_00087255 predicted 776
7 SASI_Hs01_00087256 predicted 435
8 SASI_Hs01_00087257 predicted 822
9 SASI_Hs01_00087258 predicted 595
10 SASI_Hs01_00087259 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121657 predicted 600
2 SASI_Hs01_00121658 predicted 924
3 SASI_Hs01_00121659 predicted 619
4 SASI_Hs01_00121660 predicted 513
5 SASI_Hs01_00121661 predicted 464
6 SASI_Hs01_00121662 predicted 625
7 SASI_Hs01_00121663 predicted 401
8 SASI_Hs01_00121664 predicted 398
9 SASI_Hs01_00121665 predicted 607
10 SASI_Hs01_00121666 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228472 predicted 892
2 SASI_Hs01_00228473 predicted 958
3 SASI_Hs01_00228474 predicted 541
4 SASI_Hs01_00228475 predicted 439
5 SASI_Hs01_00228476 predicted 552
6 SASI_Hs01_00228477 predicted 477
7 SASI_Hs01_00228478 predicted 532
8 SASI_Hs01_00228479 predicted 863
9 SASI_Hs01_00228480 predicted 625
10 SASI_Hs01_00228481 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041922 predicted 1066
2 SASI_Hs01_00041923 predicted 866
3 SASI_Hs01_00041924 predicted 760
4 SASI_Hs01_00041925 predicted 1070
5 SASI_Hs01_00041926 predicted 751
6 SASI_Hs01_00041927 predicted 906
7 SASI_Hs01_00041928 predicted 676
8 SASI_Hs01_00041929 predicted 1049
9 SASI_Hs01_00041930 predicted 867
10 SASI_Hs01_00041931 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378166 predicted 1010
2 SASI_Hs02_00378167 predicted 449
3 SASI_Hs02_00378168 predicted 890
4 SASI_Hs02_00378169 predicted 1373
5 SASI_Hs02_00378170 predicted 1046
6 SASI_Hs02_00378171 predicted 1571
7 SASI_Hs02_00378172 predicted 1667
8 SASI_Hs02_00378173 predicted 1771
9 SASI_Hs02_00378174 predicted 789
10 SASI_Hs02_00378175 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378176 predicted 1069
2 SASI_Hs02_00378177 predicted 539
3 SASI_Hs02_00378178 predicted 950
4 SASI_Hs02_00378179 predicted 1435
5 SASI_Hs02_00378180 predicted 1108
6 SASI_Hs02_00378181 predicted 1640
7 SASI_Hs02_00378182 predicted 1730
8 SASI_Hs02_00378183 predicted 1828
9 SASI_Hs02_00378184 predicted 859
10 SASI_Hs02_00378185 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378186 predicted 1147
2 SASI_Hs02_00378187 predicted 614
3 SASI_Hs02_00378188 predicted 450
4 SASI_Hs02_00378189 predicted 1025
5 SASI_Hs02_00378190 predicted 1174
6 SASI_Hs02_00378191 predicted 1703
7 SASI_Hs02_00378192 predicted 1794
8 SASI_Hs02_00378193 predicted 1900
9 SASI_Hs02_00378194 predicted 929
10 SASI_Hs02_00378195 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378196 predicted 883
2 SASI_Hs02_00378197 predicted 766
3 SASI_Hs02_00378198 predicted 1812
4 SASI_Hs02_00378199 predicted 1251
5 SASI_Hs02_00378200 predicted 916
6 SASI_Hs02_00378201 predicted 1449
7 SASI_Hs02_00378202 predicted 1535
8 SASI_Hs02_00378203 predicted 1645
9 SASI_Hs02_00378204 predicted 671
10 SASI_Hs02_00378205 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328167 predicted 342
2 SASI_Rn02_00328168 predicted 511
3 SASI_Rn02_00328169 predicted 239
4 SASI_Rn02_00328170 predicted 834
5 SASI_Rn02_00328171 predicted 636
6 SASI_Rn02_00328172 predicted 621
7 SASI_Rn02_00328173 predicted 204
8 SASI_Rn02_00328174 predicted 547
9 SASI_Rn02_00328175 predicted 200
10 SASI_Rn02_00328176 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328274 predicted 366
2 SASI_Rn02_00328275 predicted 523
3 SASI_Rn02_00328276 predicted 254
4 SASI_Rn02_00328277 predicted 204
5 SASI_Rn02_00328278 predicted 849
6 SASI_Rn02_00328279 predicted 651
7 SASI_Rn02_00328280 predicted 635
8 SASI_Rn02_00328281 predicted 680
9 SASI_Rn02_00328282 predicted 218
10 SASI_Rn02_00328283 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388170 predicted 526
2 SASI_Rn02_00388171 predicted 260
3 SASI_Rn02_00388172 predicted 551
4 SASI_Rn02_00388173 predicted 208
5 SASI_Rn02_00388174 predicted 526
6 SASI_Rn02_00388175 predicted 215
7 SASI_Rn02_00388176 predicted 507
8 SASI_Rn02_00388177 predicted 462
9 SASI_Rn02_00388178 predicted 196
10 SASI_Rn02_00388179 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108200 predicted 757
2 SASI_Mm01_00108201 predicted 863
3 SASI_Mm01_00108202 predicted 889
4 SASI_Mm01_00108203 predicted 748
5 SASI_Mm01_00108204 predicted 580
6 SASI_Mm01_00108205 predicted 416
7 SASI_Mm01_00108208 predicted 782
8 SASI_Mm01_00108209 predicted 359
9 SASI_Mm02_00337319 predicted 1054
10 SASI_Mm02_00337320 predicted 435
11 SASI_Mm01_00108206 predicted 488
12 SASI_Mm01_00108207 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033270
VALIDATED
E2F6 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-762s21c1
Sequence:CCGGGCGTATGTAACCTATCAGGATCTCGAGATCCTGATAGGTTACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-687s21c1
Sequence:CCGGGCCTTGGACGAGTTGATTAAACTCGAGTTTAATCAACTCGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-408s21c1
Sequence:CCGGCGGTTTGATGTGTCACTGGTACTCGAGTACCAGTGACACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033270.1-2192s21c1
Sequence:CCGGGCCCAGTGAATGTCTAGCAAACTCGAGTTTGCTAGACATTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-2192s1c1
Sequence:CCGGGCCCAGTGAATGTCTAGCAAACTCGAGTTTGCTAGACATTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-687s1c1
Sequence:CCGGGCCTTGGACGAGTTGATTAAACTCGAGTTTAATCAACTCGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-762s1c1
Sequence:CCGGGCGTATGTAACCTATCAGGATCTCGAGATCCTGATAGGTTACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-408s1c1
Sequence:CCGGCGGTTTGATGTGTCACTGGTACTCGAGTACCAGTGACACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-764s1c1
Sequence:CCGGGTATGTAACCTATCAGGATATCTCGAGATATCCTGATAGGTTACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033270
VALIDATED
E2F6 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-762s21c1
Sequence:CCGGGCGTATGTAACCTATCAGGATCTCGAGATCCTGATAGGTTACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-687s21c1
Sequence:CCGGGCCTTGGACGAGTTGATTAAACTCGAGTTTAATCAACTCGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-408s21c1
Sequence:CCGGCGGTTTGATGTGTCACTGGTACTCGAGTACCAGTGACACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033270.1-2192s21c1
Sequence:CCGGGCCCAGTGAATGTCTAGCAAACTCGAGTTTGCTAGACATTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-2192s1c1
Sequence:CCGGGCCCAGTGAATGTCTAGCAAACTCGAGTTTGCTAGACATTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-687s1c1
Sequence:CCGGGCCTTGGACGAGTTGATTAAACTCGAGTTTAATCAACTCGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-762s1c1
Sequence:CCGGGCGTATGTAACCTATCAGGATCTCGAGATCCTGATAGGTTACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-408s1c1
Sequence:CCGGCGGTTTGATGTGTCACTGGTACTCGAGTACCAGTGACACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-764s1c1
Sequence:CCGGGTATGTAACCTATCAGGATATCTCGAGATATCCTGATAGGTTACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033270
VALIDATED
E2F6 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-762s21c1
Sequence:CCGGGCGTATGTAACCTATCAGGATCTCGAGATCCTGATAGGTTACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-687s21c1
Sequence:CCGGGCCTTGGACGAGTTGATTAAACTCGAGTTTAATCAACTCGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033270.1-408s21c1
Sequence:CCGGCGGTTTGATGTGTCACTGGTACTCGAGTACCAGTGACACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033270.1-2192s21c1
Sequence:CCGGGCCCAGTGAATGTCTAGCAAACTCGAGTTTGCTAGACATTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-2192s1c1
Sequence:CCGGGCCCAGTGAATGTCTAGCAAACTCGAGTTTGCTAGACATTCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-687s1c1
Sequence:CCGGGCCTTGGACGAGTTGATTAAACTCGAGTTTAATCAACTCGTCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-762s1c1
Sequence:CCGGGCGTATGTAACCTATCAGGATCTCGAGATCCTGATAGGTTACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-408s1c1
Sequence:CCGGCGGTTTGATGTGTCACTGGTACTCGAGTACCAGTGACACATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033270.1-764s1c1
Sequence:CCGGGTATGTAACCTATCAGGATATCTCGAGATATCCTGATAGGTTACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198256
VALIDATED
E2F6 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-646s21c1
Sequence:CCGGGAAATCCAAGAACCATATTAGCTCGAGCTAATATGGTTCTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-975s21c1
Sequence:CCGGACGGACCTATCGATGTCTATTCTCGAGAATAGACATCGATAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198256.2-1548s21c1
Sequence:CCGGATAGATGTACACACGAATTTACTCGAGTAAATTCGTGTGTACATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198256.2-873s21c1
Sequence:CCGGTCCATGAACAGATCGTCATTGCTCGAGCAATGACGATCTGTTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-483s21c1
Sequence:CCGGTTGATGTATCGCTGGTTTATTCTCGAGAATAAACCAGCGATACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198256
VALIDATED
E2F6 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-646s21c1
Sequence:CCGGGAAATCCAAGAACCATATTAGCTCGAGCTAATATGGTTCTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-975s21c1
Sequence:CCGGACGGACCTATCGATGTCTATTCTCGAGAATAGACATCGATAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198256.2-1548s21c1
Sequence:CCGGATAGATGTACACACGAATTTACTCGAGTAAATTCGTGTGTACATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198256.2-873s21c1
Sequence:CCGGTCCATGAACAGATCGTCATTGCTCGAGCAATGACGATCTGTTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-483s21c1
Sequence:CCGGTTGATGTATCGCTGGTTTATTCTCGAGAATAAACCAGCGATACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198256
VALIDATED
E2F6 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-646s21c1
Sequence:CCGGGAAATCCAAGAACCATATTAGCTCGAGCTAATATGGTTCTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-975s21c1
Sequence:CCGGACGGACCTATCGATGTCTATTCTCGAGAATAGACATCGATAGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198256.2-1548s21c1
Sequence:CCGGATAGATGTACACACGAATTTACTCGAGTAAATTCGTGTGTACATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198256.2-873s21c1
Sequence:CCGGTCCATGAACAGATCGTCATTGCTCGAGCAATGACGATCTGTTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_198256.2-483s21c1
Sequence:CCGGTTGATGTATCGCTGGTTTATTCTCGAGAATAAACCAGCGATACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001952
E2F6 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001952.3-1292s1c1
Sequence:CCGGCCACTTAGATTACTGAGTAATCTCGAGATTACTCAGTAATCTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-985s1c1
Sequence:CCGGCGATGTCTATTTGTGTGAAGTCTCGAGACTTCACACAAATAGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-493s1c1
Sequence:CCGGGCTGGTTTATTTAACTCGAAACTCGAGTTTCGAGTTAAATAAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-596s1c1
Sequence:CCGGAGAGTGTATGACATCACCAATCTCGAGATTGGTGATGTCATACACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-723s1c1
Sequence:CCGGAGGAGGAACTTTCTGACTTATCTCGAGATAAGTCAGAAAGTTCCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001952
E2F6 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001952.3-1292s1c1
Sequence:CCGGCCACTTAGATTACTGAGTAATCTCGAGATTACTCAGTAATCTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-985s1c1
Sequence:CCGGCGATGTCTATTTGTGTGAAGTCTCGAGACTTCACACAAATAGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-493s1c1
Sequence:CCGGGCTGGTTTATTTAACTCGAAACTCGAGTTTCGAGTTAAATAAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-596s1c1
Sequence:CCGGAGAGTGTATGACATCACCAATCTCGAGATTGGTGATGTCATACACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-723s1c1
Sequence:CCGGAGGAGGAACTTTCTGACTTATCTCGAGATAAGTCAGAAAGTTCCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001952
E2F6 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001952.3-1292s1c1
Sequence:CCGGCCACTTAGATTACTGAGTAATCTCGAGATTACTCAGTAATCTAAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-985s1c1
Sequence:CCGGCGATGTCTATTTGTGTGAAGTCTCGAGACTTCACACAAATAGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-493s1c1
Sequence:CCGGGCTGGTTTATTTAACTCGAAACTCGAGTTTCGAGTTAAATAAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-596s1c1
Sequence:CCGGAGAGTGTATGACATCACCAATCTCGAGATTGGTGATGTCATACACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001952.3-723s1c1
Sequence:CCGGAGGAGGAACTTTCTGACTTATCTCGAGATAAGTCAGAAAGTTCCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks