EMAIL THIS PAGE TO A FRIEND

E2F7

E2F transcription factor 7

183 Gene Product Result for
UniProtKB ID: Q96AV8, A6NC74, B2RMR7, B3KTZ5, B3KUP8, B5MED9
Gene ID:
Human(144455) Summary: E2F transcription factors, such as E2F7, play an essential role in the regulation of cell cycle progression (Di Stefano et al., 2003 [PubMed 14633988]
Mouse(52679) E2F transcription factor 7
Rat(314818) E2F transcription factor 7
Zebrafish(567941) E2F transcription factor 7
cow(526129) E2F transcription factor 7
Horse(100050373) E2F transcription factor 7
domestic cat(101085053) E2F transcription factor 7
dog(482575) E2F transcription factor 7
chicken(417868) E2F transcription factor 7
domestic guinea pig(100734186) E2F transcription factor 7
naked mole-rat(101703709) E2F transcription factor 7
sheep(101102051) E2F transcription factor 7
Domestic Rabbit(100357309) E2F transcription factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203394 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077721 MISSION® esiRNA esiRNA human E2F7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203394 Rosetta Predictions human pricing
NM_001108092 Rosetta Predictions rat pricing
NM_178609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069153 predicted 1300
2 SASI_Hs01_00069154 predicted 1704
3 SASI_Hs02_00373325 predicted 2220
4 SASI_Hs01_00069155 predicted 709
5 SASI_Hs01_00069157 predicted 1009
6 SASI_Hs01_00069158 predicted 2176
7 SASI_Hs01_00069159 predicted 1411
8 SASI_Hs02_00373326 predicted 1530
9 SASI_Hs01_00069160 predicted 2689
10 SASI_Hs01_00069161 predicted 2891
11 SASI_Hs01_00069152 predicted 1267
12 SASI_Hs01_00069156 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235274 predicted 520
2 SASI_Rn02_00235275 predicted 1799
3 SASI_Rn02_00235276 predicted 1189
4 SASI_Rn02_00235277 predicted 1506
5 SASI_Rn02_00235278 predicted 1113
6 SASI_Rn02_00235279 predicted 881
7 SASI_Rn02_00235280 predicted 786
8 SASI_Rn02_00235281 predicted 1244
9 SASI_Rn02_00235282 predicted 1791
10 SASI_Rn02_00235283 predicted 1978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147836 predicted 1262
2 SASI_Mm02_00348959 predicted 2242
3 SASI_Mm01_00147837 predicted 2622
4 SASI_Mm01_00147838 predicted 2029
5 SASI_Mm01_00147839 predicted 1681
6 SASI_Mm01_00147840 predicted 2060
7 SASI_Mm01_00147841 predicted 1124
8 SASI_Mm01_00147842 predicted 1198
9 SASI_Mm01_00147843 predicted 1119
10 SASI_Mm01_00147844 predicted 1526
11 SASI_Mm01_00147845 predicted 2475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178609
VALIDATED
E2F7 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-3448s1c1
Sequence:CCGGGCACTTATTCTACAGCTTATTCTCGAGAATAAGCTGTAGAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-2465s1c1
Sequence:CCGGAGTTCTCTATTCTCCCGCAATCTCGAGATTGCGGGAGAATAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-368s1c1
Sequence:CCGGCGACCTGTCAAAGCAAAGAATCTCGAGATTCTTTGCTTTGACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-1786s1c1
Sequence:CCGGCCTCCGACACAGAGAACTTAACTCGAGTTAAGTTCTCTGTGTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-1215s1c1
Sequence:CCGGAGGCTCTATGACATAGCCAATCTCGAGATTGGCTATGTCATAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1709s21c1
Sequence:CCGGTGTTGCTCAAACAGATTTGCCCTCGAGGGCAAATCTGTTTGAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1853s21c1
Sequence:CCGGCACCCAACTCTTCATGCTGTACTCGAGTACAGCATGAAGAGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1745s21c1
Sequence:CCGGGAATGGTCCAAGCGGACAAGTCTCGAGACTTGTCCGCTTGGACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178609
VALIDATED
E2F7 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-3448s1c1
Sequence:CCGGGCACTTATTCTACAGCTTATTCTCGAGAATAAGCTGTAGAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-2465s1c1
Sequence:CCGGAGTTCTCTATTCTCCCGCAATCTCGAGATTGCGGGAGAATAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-368s1c1
Sequence:CCGGCGACCTGTCAAAGCAAAGAATCTCGAGATTCTTTGCTTTGACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-1786s1c1
Sequence:CCGGCCTCCGACACAGAGAACTTAACTCGAGTTAAGTTCTCTGTGTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-1215s1c1
Sequence:CCGGAGGCTCTATGACATAGCCAATCTCGAGATTGGCTATGTCATAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1709s21c1
Sequence:CCGGTGTTGCTCAAACAGATTTGCCCTCGAGGGCAAATCTGTTTGAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1853s21c1
Sequence:CCGGCACCCAACTCTTCATGCTGTACTCGAGTACAGCATGAAGAGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1745s21c1
Sequence:CCGGGAATGGTCCAAGCGGACAAGTCTCGAGACTTGTCCGCTTGGACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178609
VALIDATED
E2F7 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-3448s1c1
Sequence:CCGGGCACTTATTCTACAGCTTATTCTCGAGAATAAGCTGTAGAATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-2465s1c1
Sequence:CCGGAGTTCTCTATTCTCCCGCAATCTCGAGATTGCGGGAGAATAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-368s1c1
Sequence:CCGGCGACCTGTCAAAGCAAAGAATCTCGAGATTCTTTGCTTTGACAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-1786s1c1
Sequence:CCGGCCTCCGACACAGAGAACTTAACTCGAGTTAAGTTCTCTGTGTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178609.3-1215s1c1
Sequence:CCGGAGGCTCTATGACATAGCCAATCTCGAGATTGGCTATGTCATAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1709s21c1
Sequence:CCGGTGTTGCTCAAACAGATTTGCCCTCGAGGGCAAATCTGTTTGAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1853s21c1
Sequence:CCGGCACCCAACTCTTCATGCTGTACTCGAGTACAGCATGAAGAGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178609.4-1745s21c1
Sequence:CCGGGAATGGTCCAAGCGGACAAGTCTCGAGACTTGTCCGCTTGGACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203394
VALIDATED
E2F7 MISSION shRNA Bacterial Glycerol Stock
E2F transcription factor 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-1223s1c1
Sequence:CCGGCGCCTCTATGACATAGCCAATCTCGAGATTGGCTATGTCATAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-1259s1c1
Sequence:CCGGGCTCTGATAAAGAAAGTGCATCTCGAGATGCACTTTCTTTATCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-824s1c1
Sequence:CCGGCGGGTGGCTAAGAATCAGTATCTCGAGATACTGATTCTTAGCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-776s1c1
Sequence:CCGGCGCATCTATGACATTGTAAATCTCGAGATTTACAATGTCATAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_203394.1-2228s1c1
Sequence:CCGGGCAACAGCAAACTCTCTTGTTCTCGAGAACAAGAGAGTTTGCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203394.2-963s21c1
Sequence:CCGGCTGGACCTGATAGATTATAAACTCGAGTTTATAATCTATCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203394.2-511s21c1
Sequence:CCGGGTGCTGCCAGCCCAGATATAACTCGAGTTATATCTGGGCTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203394.2-5194s21c1
Sequence:CCGGCTGCGCTAGACTTGGATATTTCTCGAGAAATATCCAAGTCTAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203394.2-2363s21c1
Sequence:CCGGGCAGTCTCCTGCAGGATTAAACTCGAGTTTAATCCTGCAGGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203394.2-699s21c1
Sequence:CCGGCTAGCTCGCTATCCAAGTTATCTCGAGATAACTTGGATAGCGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203394
VALIDATED
E2F7 MISSION shRNA shRNA Plasmid DNA
E2F transcription factor 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-1223s1c1
Sequence:CCGGCGCCTCTATGACATAGCCAATCTCGAGATTGGCTATGTCATAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-1259s1c1
Sequence:CCGGGCTCTGATAAAGAAAGTGCATCTCGAGATGCACTTTCTTTATCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-824s1c1
Sequence:CCGGCGGGTGGCTAAGAATCAGTATCTCGAGATACTGATTCTTAGCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-776s1c1
Sequence:CCGGCGCATCTATGACATTGTAAATCTCGAGATTTACAATGTCATAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_203394.1-2228s1c1
Sequence:CCGGGCAACAGCAAACTCTCTTGTTCTCGAGAACAAGAGAGTTTGCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203394.2-963s21c1
Sequence:CCGGCTGGACCTGATAGATTATAAACTCGAGTTTATAATCTATCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203394.2-511s21c1
Sequence:CCGGGTGCTGCCAGCCCAGATATAACTCGAGTTATATCTGGGCTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203394.2-5194s21c1
Sequence:CCGGCTGCGCTAGACTTGGATATTTCTCGAGAAATATCCAAGTCTAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203394.2-2363s21c1
Sequence:CCGGGCAGTCTCCTGCAGGATTAAACTCGAGTTTAATCCTGCAGGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203394.2-699s21c1
Sequence:CCGGCTAGCTCGCTATCCAAGTTATCTCGAGATAACTTGGATAGCGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203394
VALIDATED
E2F7 MISSION shRNA Lentiviral Transduction Particles
E2F transcription factor 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-1223s1c1
Sequence:CCGGCGCCTCTATGACATAGCCAATCTCGAGATTGGCTATGTCATAGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-1259s1c1
Sequence:CCGGGCTCTGATAAAGAAAGTGCATCTCGAGATGCACTTTCTTTATCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-824s1c1
Sequence:CCGGCGGGTGGCTAAGAATCAGTATCTCGAGATACTGATTCTTAGCCACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203394.1-776s1c1
Sequence:CCGGCGCATCTATGACATTGTAAATCTCGAGATTTACAATGTCATAGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_203394.1-2228s1c1
Sequence:CCGGGCAACAGCAAACTCTCTTGTTCTCGAGAACAAGAGAGTTTGCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203394.2-963s21c1
Sequence:CCGGCTGGACCTGATAGATTATAAACTCGAGTTTATAATCTATCAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203394.2-511s21c1
Sequence:CCGGGTGCTGCCAGCCCAGATATAACTCGAGTTATATCTGGGCTGGCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203394.2-5194s21c1
Sequence:CCGGCTGCGCTAGACTTGGATATTTCTCGAGAAATATCCAAGTCTAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203394.2-2363s21c1
Sequence:CCGGGCAGTCTCCTGCAGGATTAAACTCGAGTTTAATCCTGCAGGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203394.2-699s21c1
Sequence:CCGGCTAGCTCGCTATCCAAGTTATCTCGAGATAACTTGGATAGCGAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks