EMAIL THIS PAGE TO A FRIEND

E4F1

E4F transcription factor 1

Synonyms: E4F
UniProtKB ID: Q66K89, A8K2R4, O00146
Gene ID:
Human(1877) Summary: The zinc finger protein encoded by this gene is one of several cellular transcription factors whose DNA-binding activities are regulated through the action of adenovirus E1A. A 50-kDa amino-terminal product is generated from the full-length protein through proteolytic cleavage. The protein is differentially regulated by E1A-induced phosphorylation. The full-length gene product represses transcription from the E4 promoter in the absence of E1A, while the 50-kDa form acts as a transcriptional activator in its presence. [provided by RefSeq, Jul 2008]
Mouse(13560) E4F transcription factor 1
Rat(681359) E4F transcription factor 1
sheep(101115422) E4F transcription factor 1
domestic guinea pig(100733176) E4F transcription factor 1
naked mole-rat(101703707) E4F transcription factor 1
Zebrafish(561158) E4F transcription factor 1
chicken(416560) E4F transcription factor 1
cow(515997) E4F transcription factor 1
domestic cat(101081945) E4F transcription factor 1
dog(100683433) E4F transcription factor 1
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004424 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004424 Rosetta Predictions human pricing
XM_001061399 Rosetta Predictions rat pricing
NM_007893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244180 predicted 584
2 SASI_Hs01_00244181 predicted 385
3 SASI_Hs01_00244182 predicted 1956
4 SASI_Hs01_00244183 predicted 827
5 SASI_Hs01_00244184 predicted 972
6 SASI_Hs01_00244185 predicted 1902
7 SASI_Hs01_00244186 predicted 875
8 SASI_Hs01_00244187 predicted 1000
9 SASI_Hs01_00244188 predicted 827
10 SASI_Hs01_00244189 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299927 predicted 1728
2 SASI_Rn02_00299928 predicted 1598
3 SASI_Rn02_00299929 predicted 1444
4 SASI_Rn02_00299930 predicted 1653
5 SASI_Rn02_00299931 predicted 1539
6 SASI_Rn02_00299932 predicted 1193
7 SASI_Rn02_00299933 predicted 709
8 SASI_Rn02_00299934 predicted 482
9 SASI_Rn02_00299935 predicted 832
10 SASI_Rn02_00299936 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060727 predicted 1117
2 SASI_Mm01_00060728 predicted 1121
3 SASI_Mm02_00312683 predicted 557
4 SASI_Mm01_00060729 predicted 230
5 SASI_Mm01_00060731 predicted 1603
6 SASI_Mm01_00060732 predicted 1099
7 SASI_Mm01_00060733 predicted 1925
8 SASI_Mm01_00060734 predicted 1610
9 SASI_Mm01_00060735 predicted 818
10 SASI_Mm01_00060736 predicted 357
11 SASI_Mm01_00060730 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007893
VALIDATED
E4F1 MISSION shRNA Bacterial Glycerol Stock
E4F transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-2051s1c1
Sequence:CCGGCCACTGTGACAATGGTGTCATCTCGAGATGACACCATTGTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1717s1c1
Sequence:CCGGGATACCCAAGAGTACATTATTCTCGAGAATAATGTACTCTTGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1861s1c1
Sequence:CCGGCACCAGATCATCGTGCAGAATCTCGAGATTCTGCACGATGATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1715s1c1
Sequence:CCGGCTGATACCCAAGAGTACATTACTCGAGTAATGTACTCTTGGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007893.1-396s1c1
Sequence:CCGGGCTATGTCACAAGACCTTCAACTCGAGTTGAAGGTCTTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-2356s21c1
Sequence:CCGGAGACGGTCATCGTATAGTTTGCTCGAGCAAACTATACGATGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1497s21c1
Sequence:CCGGGGAGACTGTGGGAAGCTTTACCTCGAGGTAAAGCTTCCCACAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007893.3-2396s21c1
Sequence:CCGGATCGAGGACCCTGAGTGTCTGCTCGAGCAGACACTCAGGGTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1928s21c1
Sequence:CCGGTGATACCCAAGAGTACATTATCTCGAGATAATGTACTCTTGGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1978s21c1
Sequence:CCGGGTGAAGCCACCGAGATCATTGCTCGAGCAATGATCTCGGTGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007893
VALIDATED
E4F1 MISSION shRNA shRNA Plasmid DNA
E4F transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-2051s1c1
Sequence:CCGGCCACTGTGACAATGGTGTCATCTCGAGATGACACCATTGTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1717s1c1
Sequence:CCGGGATACCCAAGAGTACATTATTCTCGAGAATAATGTACTCTTGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1861s1c1
Sequence:CCGGCACCAGATCATCGTGCAGAATCTCGAGATTCTGCACGATGATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1715s1c1
Sequence:CCGGCTGATACCCAAGAGTACATTACTCGAGTAATGTACTCTTGGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007893.1-396s1c1
Sequence:CCGGGCTATGTCACAAGACCTTCAACTCGAGTTGAAGGTCTTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-2356s21c1
Sequence:CCGGAGACGGTCATCGTATAGTTTGCTCGAGCAAACTATACGATGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1497s21c1
Sequence:CCGGGGAGACTGTGGGAAGCTTTACCTCGAGGTAAAGCTTCCCACAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007893.3-2396s21c1
Sequence:CCGGATCGAGGACCCTGAGTGTCTGCTCGAGCAGACACTCAGGGTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1928s21c1
Sequence:CCGGTGATACCCAAGAGTACATTATCTCGAGATAATGTACTCTTGGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1978s21c1
Sequence:CCGGGTGAAGCCACCGAGATCATTGCTCGAGCAATGATCTCGGTGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007893
VALIDATED
E4F1 MISSION shRNA Lentiviral Transduction Particles
E4F transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-2051s1c1
Sequence:CCGGCCACTGTGACAATGGTGTCATCTCGAGATGACACCATTGTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1717s1c1
Sequence:CCGGGATACCCAAGAGTACATTATTCTCGAGAATAATGTACTCTTGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1861s1c1
Sequence:CCGGCACCAGATCATCGTGCAGAATCTCGAGATTCTGCACGATGATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007893.1-1715s1c1
Sequence:CCGGCTGATACCCAAGAGTACATTACTCGAGTAATGTACTCTTGGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007893.1-396s1c1
Sequence:CCGGGCTATGTCACAAGACCTTCAACTCGAGTTGAAGGTCTTGTGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-2356s21c1
Sequence:CCGGAGACGGTCATCGTATAGTTTGCTCGAGCAAACTATACGATGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1497s21c1
Sequence:CCGGGGAGACTGTGGGAAGCTTTACCTCGAGGTAAAGCTTCCCACAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007893.3-2396s21c1
Sequence:CCGGATCGAGGACCCTGAGTGTCTGCTCGAGCAGACACTCAGGGTCCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1928s21c1
Sequence:CCGGTGATACCCAAGAGTACATTATCTCGAGATAATGTACTCTTGGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007893.3-1978s21c1
Sequence:CCGGGTGAAGCCACCGAGATCATTGCTCGAGCAATGATCTCGGTGGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004424
E4F1 MISSION shRNA Bacterial Glycerol Stock
E4F transcription factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004424.2-2411s1c1
Sequence:CCGGGACAGGGCAGAGGACTCTGAACTCGAGTTCAGAGTCCTCTGCCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-243s1c1
Sequence:CCGGTGTTCAGCACAAGATTCAGAACTCGAGTTCTGAATCTTGTGCTGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1603s1c1
Sequence:CCGGCGCTACAAGACTAAGAACGCACTCGAGTGCGTTCTTAGTCTTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1899s1c1
Sequence:CCGGGCACACAGTGTTGGTGGAGTTCTCGAGAACTCCACCAACACTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1740s1c1
Sequence:CCGGGAAGCCGTTCAAGTGCTACAACTCGAGTTGTAGCACTTGAACGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-605s21c1
Sequence:CCGGTGAACAAGGATGGCCGCTATGCTCGAGCATAGCGGCCATCCTTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-2388s21c1
Sequence:CCGGGACGGTCATCGTCTAGCATGACTCGAGTCATGCTAGACGATGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-461s21c1
Sequence:CCGGTTGGTGGTGGGCACATCAAAGCTCGAGCTTTGATGTGCCCACCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-896s21c1
Sequence:CCGGAGGACGTGGTTGTCAGCAAAGCTCGAGCTTTGCTGACAACCACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-992s21c1
Sequence:CCGGTAGAGACTTCACCCGTGATTCCTCGAGGAATCACGGGTGAAGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004424
E4F1 MISSION shRNA shRNA Plasmid DNA
E4F transcription factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004424.2-2411s1c1
Sequence:CCGGGACAGGGCAGAGGACTCTGAACTCGAGTTCAGAGTCCTCTGCCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-243s1c1
Sequence:CCGGTGTTCAGCACAAGATTCAGAACTCGAGTTCTGAATCTTGTGCTGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1603s1c1
Sequence:CCGGCGCTACAAGACTAAGAACGCACTCGAGTGCGTTCTTAGTCTTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1899s1c1
Sequence:CCGGGCACACAGTGTTGGTGGAGTTCTCGAGAACTCCACCAACACTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1740s1c1
Sequence:CCGGGAAGCCGTTCAAGTGCTACAACTCGAGTTGTAGCACTTGAACGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-605s21c1
Sequence:CCGGTGAACAAGGATGGCCGCTATGCTCGAGCATAGCGGCCATCCTTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-2388s21c1
Sequence:CCGGGACGGTCATCGTCTAGCATGACTCGAGTCATGCTAGACGATGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-461s21c1
Sequence:CCGGTTGGTGGTGGGCACATCAAAGCTCGAGCTTTGATGTGCCCACCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-896s21c1
Sequence:CCGGAGGACGTGGTTGTCAGCAAAGCTCGAGCTTTGCTGACAACCACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-992s21c1
Sequence:CCGGTAGAGACTTCACCCGTGATTCCTCGAGGAATCACGGGTGAAGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004424
E4F1 MISSION shRNA Lentiviral Transduction Particles
E4F transcription factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004424.2-2411s1c1
Sequence:CCGGGACAGGGCAGAGGACTCTGAACTCGAGTTCAGAGTCCTCTGCCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-243s1c1
Sequence:CCGGTGTTCAGCACAAGATTCAGAACTCGAGTTCTGAATCTTGTGCTGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1603s1c1
Sequence:CCGGCGCTACAAGACTAAGAACGCACTCGAGTGCGTTCTTAGTCTTGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1899s1c1
Sequence:CCGGGCACACAGTGTTGGTGGAGTTCTCGAGAACTCCACCAACACTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004424.2-1740s1c1
Sequence:CCGGGAAGCCGTTCAAGTGCTACAACTCGAGTTGTAGCACTTGAACGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-605s21c1
Sequence:CCGGTGAACAAGGATGGCCGCTATGCTCGAGCATAGCGGCCATCCTTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-2388s21c1
Sequence:CCGGGACGGTCATCGTCTAGCATGACTCGAGTCATGCTAGACGATGACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-461s21c1
Sequence:CCGGTTGGTGGTGGGCACATCAAAGCTCGAGCTTTGATGTGCCCACCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-896s21c1
Sequence:CCGGAGGACGTGGTTGTCAGCAAAGCTCGAGCTTTGCTGACAACCACGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004424.3-992s21c1
Sequence:CCGGTAGAGACTTCACCCGTGATTCCTCGAGGAATCACGGGTGAAGTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks