EMAIL THIS PAGE TO A FRIEND

EAF1

ELL associated factor 1

149 Gene Product Result for
UniProtKB ID: Q96JC9, Q8IW10
Gene ID:
Mouse(74427) ELL associated factor 1
Rat(306261) ELL associated factor 1
Zebrafish(415205) ELL associated factor 1
cow(507577) ELL associated factor 1
dog(485656) ELL associated factor 1
domestic cat(101092882) ELL associated factor 1
chicken(776372) ELL associated factor 1
domestic guinea pig(100732354) ELL associated factor 1
naked mole-rat(101708510) ELL associated factor 1
sheep(101112699) ELL associated factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033083 Rosetta Predictions human pricing
NM_001107293 Rosetta Predictions rat pricing
NM_028932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012884 predicted 1218
2 SASI_Hs01_00012885 predicted 355
3 SASI_Hs01_00012886 predicted 1167
4 SASI_Hs01_00012887 predicted 756
5 SASI_Hs01_00012888 predicted 366
6 SASI_Hs01_00012889 predicted 1263
7 SASI_Hs01_00012890 predicted 955
8 SASI_Hs01_00012891 predicted 1307
9 SASI_Hs01_00012892 predicted 650
10 SASI_Hs02_00360785 predicted 974
11 SASI_Hs01_00012893 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227415 predicted 1903
2 SASI_Rn02_00227416 predicted 2003
3 SASI_Rn02_00227417 predicted 1932
4 SASI_Rn02_00227418 predicted 1913
5 SASI_Rn02_00227419 predicted 1657
6 SASI_Rn02_00227420 predicted 1980
7 SASI_Rn02_00227421 predicted 996
8 SASI_Rn02_00227422 predicted 1961
9 SASI_Rn02_00227423 predicted 1796
10 SASI_Rn02_00227424 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334627 predicted 1125
2 SASI_Mm02_00334628 predicted 1121
3 SASI_Mm02_00334629 predicted 868
4 SASI_Mm02_00334630 predicted 1127
5 SASI_Mm02_00334631 predicted 1019
6 SASI_Mm02_00334632 predicted 1180
7 SASI_Mm02_00334633 predicted 355
8 SASI_Mm02_00334634 predicted 1028
9 SASI_Mm02_00334635 predicted 292
10 SASI_Mm02_00334636 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033083
VALIDATED
EAF1 MISSION shRNA Bacterial Glycerol Stock
ELL associated factor 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-900s21c1
Sequence:CCGGACCAGCAGCCCTACAACAGTACTCGAGTACTGTTGTAGGGCTGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-1029s21c1
Sequence:CCGGAGTGCTGGATCTTTCGAAACCCTCGAGGGTTTCGAAAGATCCAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-495s21c1
Sequence:CCGGATCATGACACTGGTGAATATGCTCGAGCATATTCACCAGTGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-753s21c1
Sequence:CCGGTGAGGGCTGAAGTTGACATTACTCGAGTAATGTCAACTTCAGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-472s21c1
Sequence:CCGGGAAAGACTGTGTGCTTATTATCTCGAGATAATAAGCACACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-653s21c1
Sequence:CCGGCCATTCAGAGCTCCAACGAAGCTCGAGCTTCGTTGGAGCTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-721s21c1
Sequence:CCGGTGAACCTCAGTTGGATGACATCTCGAGATGTCATCCAACTGAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-1027s1c1
Sequence:CCGGCTTCGGGAAGTGATGACGATACTCGAGTATCGTCATCACTTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-1180s1c1
Sequence:CCGGCCCTCAGAAATGACTTGCAGTCTCGAGACTGCAAGTCATTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_033083.5-1522s1c1
Sequence:CCGGGCCCTGGTCTAAGTTACTCAACTCGAGTTGAGTAACTTAGACCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-731s1c1
Sequence:CCGGCAGTAGCAGCATTCAGGTGAACTCGAGTTCACCTGAATGCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-1175s1c1
Sequence:CCGGGAACACCCTCAGAAATGACTTCTCGAGAAGTCATTTCTGAGGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_033083.5-1523s1c1
Sequence:CCGGCCCTGGTCTAAGTTACTCAAACTCGAGTTTGAGTAACTTAGACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-671s1c1
Sequence:CCGGCCAGAAAGACTGTGTGCTTATCTCGAGATAAGCACACAGTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-543s1c1
Sequence:CCGGGCATCTATAGACACTTCCTGTCTCGAGACAGGAAGTGTCTATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033083
VALIDATED
EAF1 MISSION shRNA shRNA Plasmid DNA
ELL associated factor 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-900s21c1
Sequence:CCGGACCAGCAGCCCTACAACAGTACTCGAGTACTGTTGTAGGGCTGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-1029s21c1
Sequence:CCGGAGTGCTGGATCTTTCGAAACCCTCGAGGGTTTCGAAAGATCCAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-495s21c1
Sequence:CCGGATCATGACACTGGTGAATATGCTCGAGCATATTCACCAGTGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-753s21c1
Sequence:CCGGTGAGGGCTGAAGTTGACATTACTCGAGTAATGTCAACTTCAGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-472s21c1
Sequence:CCGGGAAAGACTGTGTGCTTATTATCTCGAGATAATAAGCACACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-653s21c1
Sequence:CCGGCCATTCAGAGCTCCAACGAAGCTCGAGCTTCGTTGGAGCTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-721s21c1
Sequence:CCGGTGAACCTCAGTTGGATGACATCTCGAGATGTCATCCAACTGAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-1027s1c1
Sequence:CCGGCTTCGGGAAGTGATGACGATACTCGAGTATCGTCATCACTTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-1180s1c1
Sequence:CCGGCCCTCAGAAATGACTTGCAGTCTCGAGACTGCAAGTCATTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_033083.5-1522s1c1
Sequence:CCGGGCCCTGGTCTAAGTTACTCAACTCGAGTTGAGTAACTTAGACCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-731s1c1
Sequence:CCGGCAGTAGCAGCATTCAGGTGAACTCGAGTTCACCTGAATGCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-1175s1c1
Sequence:CCGGGAACACCCTCAGAAATGACTTCTCGAGAAGTCATTTCTGAGGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_033083.5-1523s1c1
Sequence:CCGGCCCTGGTCTAAGTTACTCAAACTCGAGTTTGAGTAACTTAGACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-671s1c1
Sequence:CCGGCCAGAAAGACTGTGTGCTTATCTCGAGATAAGCACACAGTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-543s1c1
Sequence:CCGGGCATCTATAGACACTTCCTGTCTCGAGACAGGAAGTGTCTATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033083
VALIDATED
EAF1 MISSION shRNA Lentiviral Transduction Particles
ELL associated factor 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-900s21c1
Sequence:CCGGACCAGCAGCCCTACAACAGTACTCGAGTACTGTTGTAGGGCTGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-1029s21c1
Sequence:CCGGAGTGCTGGATCTTTCGAAACCCTCGAGGGTTTCGAAAGATCCAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-495s21c1
Sequence:CCGGATCATGACACTGGTGAATATGCTCGAGCATATTCACCAGTGTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-753s21c1
Sequence:CCGGTGAGGGCTGAAGTTGACATTACTCGAGTAATGTCAACTTCAGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-472s21c1
Sequence:CCGGGAAAGACTGTGTGCTTATTATCTCGAGATAATAAGCACACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-653s21c1
Sequence:CCGGCCATTCAGAGCTCCAACGAAGCTCGAGCTTCGTTGGAGCTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033083.6-721s21c1
Sequence:CCGGTGAACCTCAGTTGGATGACATCTCGAGATGTCATCCAACTGAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-1027s1c1
Sequence:CCGGCTTCGGGAAGTGATGACGATACTCGAGTATCGTCATCACTTCCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-1180s1c1
Sequence:CCGGCCCTCAGAAATGACTTGCAGTCTCGAGACTGCAAGTCATTTCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_033083.5-1522s1c1
Sequence:CCGGGCCCTGGTCTAAGTTACTCAACTCGAGTTGAGTAACTTAGACCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-731s1c1
Sequence:CCGGCAGTAGCAGCATTCAGGTGAACTCGAGTTCACCTGAATGCTGCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-1175s1c1
Sequence:CCGGGAACACCCTCAGAAATGACTTCTCGAGAAGTCATTTCTGAGGGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155130    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_033083.5-1523s1c1
Sequence:CCGGCCCTGGTCTAAGTTACTCAAACTCGAGTTTGAGTAACTTAGACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033083.5-671s1c1
Sequence:CCGGCCAGAAAGACTGTGTGCTTATCTCGAGATAAGCACACAGTCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033083.5-543s1c1
Sequence:CCGGGCATCTATAGACACTTCCTGTCTCGAGACAGGAAGTGTCTATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028932
VALIDATED
EAF1 MISSION shRNA Bacterial Glycerol Stock
ELL associated factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028932.3-375s1c1
Sequence:CCGGGAAAGACTGTGTGCTCATTATCTCGAGATAATGAGCACACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-216s21c1
Sequence:CCGGCCACACGATTCGCTACGATTTCTCGAGAAATCGTAGCGAATCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-335s21c1
Sequence:CCGGCGCCAATGACGGTGTTCAAAGCTCGAGCTTTGAACACCGTCATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028932.3-658s21c1
Sequence:CCGGAGGGCCGAGGTGGACATTATTCTCGAGAATAATGTCCACCTCGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-3160s21c1
Sequence:CCGGATGGGTAAGCCCTGGTATATACTCGAGTATATACCAGGGCTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-375s21c1
Sequence:CCGGGAAAGACTGTGTGCTCATTATCTCGAGATAATGAGCACACAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028932.2-217s1c1
Sequence:CCGGCCACACGATTCGCTACGATTTCTCGAGAAATCGTAGCGAATCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028932.2-1059s1c1
Sequence:CCGGGCACTCAGATACTCAGTCTTTCTCGAGAAAGACTGAGTATCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028932
VALIDATED
EAF1 MISSION shRNA shRNA Plasmid DNA
ELL associated factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028932.3-375s1c1
Sequence:CCGGGAAAGACTGTGTGCTCATTATCTCGAGATAATGAGCACACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-216s21c1
Sequence:CCGGCCACACGATTCGCTACGATTTCTCGAGAAATCGTAGCGAATCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-335s21c1
Sequence:CCGGCGCCAATGACGGTGTTCAAAGCTCGAGCTTTGAACACCGTCATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028932.3-658s21c1
Sequence:CCGGAGGGCCGAGGTGGACATTATTCTCGAGAATAATGTCCACCTCGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-3160s21c1
Sequence:CCGGATGGGTAAGCCCTGGTATATACTCGAGTATATACCAGGGCTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-375s21c1
Sequence:CCGGGAAAGACTGTGTGCTCATTATCTCGAGATAATGAGCACACAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028932.2-217s1c1
Sequence:CCGGCCACACGATTCGCTACGATTTCTCGAGAAATCGTAGCGAATCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028932.2-1059s1c1
Sequence:CCGGGCACTCAGATACTCAGTCTTTCTCGAGAAAGACTGAGTATCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028932
VALIDATED
EAF1 MISSION shRNA Lentiviral Transduction Particles
ELL associated factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028932.3-375s1c1
Sequence:CCGGGAAAGACTGTGTGCTCATTATCTCGAGATAATGAGCACACAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-216s21c1
Sequence:CCGGCCACACGATTCGCTACGATTTCTCGAGAAATCGTAGCGAATCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-335s21c1
Sequence:CCGGCGCCAATGACGGTGTTCAAAGCTCGAGCTTTGAACACCGTCATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028932.3-658s21c1
Sequence:CCGGAGGGCCGAGGTGGACATTATTCTCGAGAATAATGTCCACCTCGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-3160s21c1
Sequence:CCGGATGGGTAAGCCCTGGTATATACTCGAGTATATACCAGGGCTTACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028932.3-375s21c1
Sequence:CCGGGAAAGACTGTGTGCTCATTATCTCGAGATAATGAGCACACAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028932.2-217s1c1
Sequence:CCGGCCACACGATTCGCTACGATTTCTCGAGAAATCGTAGCGAATCGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028932.2-1059s1c1
Sequence:CCGGGCACTCAGATACTCAGTCTTTCTCGAGAAAGACTGAGTATCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks