EMAIL THIS PAGE TO A FRIEND

EAF2

ELL associated factor 2

88 Gene Product Result for
Synonyms: BM040 TRAITS U19
UniProtKB ID: Q96CJ1, Q9NZ82
Gene ID:
Mouse(106389) ELL associated factor 2
Rat(266787) ELL associated factor 2
Zebrafish(415252) ELL associated factor 2
chicken(424243) ELL associated factor 2
cow(613523) ELL associated factor 2
domestic cat(101085567) ELL associated factor 2
dog(608554) ELL associated factor 2
sheep(101111144) ELL associated factor 2
naked mole-rat(101722097) ELL associated factor 2
domestic guinea pig(100717551) ELL associated factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018456 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008031 MISSION® esiRNA esiRNA targeting human EAF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018456 Rosetta Predictions human pricing
NM_172047 Rosetta Predictions rat pricing
NM_001113401 Rosetta Predictions mouse pricing
NM_001113405 Rosetta Predictions mouse pricing
NM_134111 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132314 predicted 755
2 SASI_Hs02_00352007 predicted 664
3 SASI_Hs01_00132315 predicted 721
4 SASI_Hs01_00132316 predicted 771
5 SASI_Hs01_00132318 predicted 755
6 SASI_Hs02_00352008 predicted 704
7 SASI_Hs01_00132319 predicted 193
8 SASI_Hs01_00132320 predicted 785
9 SASI_Hs01_00132322 predicted 753
10 SASI_Hs01_00132323 predicted 659
11 SASI_Hs01_00132317 predicted 745
12 SASI_Hs01_00132321 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035581 predicted 640
2 SASI_Rn01_00035582 predicted 236
3 SASI_Rn01_00035583 predicted 297
4 SASI_Rn01_00035584 predicted 544
5 SASI_Rn02_00269155 predicted 619
6 SASI_Rn01_00035585 predicted 625
7 SASI_Rn01_00035586 predicted 272
8 SASI_Rn01_00035587 predicted 643
9 SASI_Rn01_00035588 predicted 323
10 SASI_Rn01_00035589 predicted 651
11 SASI_Rn01_00035590 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307736 predicted 1141
2 SASI_Mm02_00307737 predicted 1304
3 SASI_Mm02_00307738 predicted 809
4 SASI_Mm02_00307739 predicted 701
5 SASI_Mm02_00307740 predicted 1300
6 SASI_Mm02_00307741 predicted 1334
7 SASI_Mm02_00307742 predicted 841
8 SASI_Mm02_00307743 predicted 668
9 SASI_Mm02_00307744 predicted 1093
10 SASI_Mm02_00307745 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307756 predicted 780
2 SASI_Mm02_00307757 predicted 948
3 SASI_Mm02_00307758 predicted 456
4 SASI_Mm02_00307759 predicted 341
5 SASI_Mm02_00307760 predicted 945
6 SASI_Mm02_00307761 predicted 969
7 SASI_Mm02_00307762 predicted 484
8 SASI_Mm02_00307763 predicted 309
9 SASI_Mm02_00307764 predicted 738
10 SASI_Mm02_00307765 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339341 predicted 1127
2 SASI_Mm02_00339342 predicted 1292
3 SASI_Mm01_00154630 predicted 806
4 SASI_Mm01_00154631 predicted 686
5 SASI_Mm02_00339343 predicted 1292
6 SASI_Mm02_00339344 predicted 1323
7 SASI_Mm01_00154632 predicted 831
8 SASI_Mm01_00154633 predicted 655
9 SASI_Mm02_00339345 predicted 1081
10 SASI_Mm01_00154636 predicted 661
11 SASI_Mm01_00154629 predicted 507
12 SASI_Mm01_00154634 predicted 611
13 SASI_Mm01_00154635 predicted 577
14 SASI_Mm01_00154637 predicted 594
15 SASI_Mm01_00154638 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134111
EAF2 MISSION shRNA Bacterial Glycerol Stock
ELL associated factor 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-540s1c1
Sequence:CCGGGATGTCTCCAACGTCTCTAATCTCGAGATTAGAGACGTTGGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134111.2-1253s1c1
Sequence:CCGGCCTATCTGATATGCCTTAAATCTCGAGATTTAAGGCATATCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-781s1c1
Sequence:CCGGGATGCTACTTGTCACCGACTTCTCGAGAAGTCGGTGACAAGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-575s1c1
Sequence:CCGGGAGAACTGAAAGCAGAAGCTACTCGAGTAGCTTCTGCTTTCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134111.2-1417s1c1
Sequence:CCGGGCAAGATAGATGTCAGTGTTACTCGAGTAACACTGACATCTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134111.2-650s1c1
Sequence:CCGGCATCTTCAAGTAGTGAGGATACTCGAGTATCCTCACTACTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134111
EAF2 MISSION shRNA shRNA Plasmid DNA
ELL associated factor 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-540s1c1
Sequence:CCGGGATGTCTCCAACGTCTCTAATCTCGAGATTAGAGACGTTGGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134111.2-1253s1c1
Sequence:CCGGCCTATCTGATATGCCTTAAATCTCGAGATTTAAGGCATATCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-781s1c1
Sequence:CCGGGATGCTACTTGTCACCGACTTCTCGAGAAGTCGGTGACAAGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-575s1c1
Sequence:CCGGGAGAACTGAAAGCAGAAGCTACTCGAGTAGCTTCTGCTTTCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134111.2-1417s1c1
Sequence:CCGGGCAAGATAGATGTCAGTGTTACTCGAGTAACACTGACATCTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134111.2-650s1c1
Sequence:CCGGCATCTTCAAGTAGTGAGGATACTCGAGTATCCTCACTACTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134111
EAF2 MISSION shRNA Lentiviral Transduction Particles
ELL associated factor 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-540s1c1
Sequence:CCGGGATGTCTCCAACGTCTCTAATCTCGAGATTAGAGACGTTGGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134111.2-1253s1c1
Sequence:CCGGCCTATCTGATATGCCTTAAATCTCGAGATTTAAGGCATATCAGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-781s1c1
Sequence:CCGGGATGCTACTTGTCACCGACTTCTCGAGAAGTCGGTGACAAGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134111.2-575s1c1
Sequence:CCGGGAGAACTGAAAGCAGAAGCTACTCGAGTAGCTTCTGCTTTCAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193580    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134111.2-1417s1c1
Sequence:CCGGGCAAGATAGATGTCAGTGTTACTCGAGTAACACTGACATCTATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134111.2-650s1c1
Sequence:CCGGCATCTTCAAGTAGTGAGGATACTCGAGTATCCTCACTACTTGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018456
EAF2 MISSION shRNA Bacterial Glycerol Stock
ELL associated factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-772s1c1
Sequence:CCGGCCTGATATAGATGCCAGTCATCTCGAGATGACTGGCATCTATATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-383s1c1
Sequence:CCGGCTGGAGAATGTCGGCTAGAAACTCGAGTTTCTAGCCGACATTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-274s1c1
Sequence:CCGGGTGACCATAACTCTGCCAAATCTCGAGATTTGGCAGAGTTATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-203s1c1
Sequence:CCGGGCTATGACTTCAAACCTGCTTCTCGAGAAGCAGGTTTGAAGTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-704s1c1
Sequence:CCGGGCAAATCCTCTACTTCTGATACTCGAGTATCAGAAGTAGAGGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-815s21c1
Sequence:CCGGGCCTTCTGATGAATACTTTAACTCGAGTTAAAGTATTCATCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-436s21c1
Sequence:CCGGAGAGTTGAAGGAAGCAGTAAACTCGAGTTTACTGCTTCCTTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-300s21c1
Sequence:CCGGAGGTTCAACTCCACCAGTAACCTCGAGGTTACTGGTGGAGTTGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-588s21c1
Sequence:CCGGGAAGGCAGAAGCTAGTCTAATCTCGAGATTAGACTAGCTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018456
EAF2 MISSION shRNA shRNA Plasmid DNA
ELL associated factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-772s1c1
Sequence:CCGGCCTGATATAGATGCCAGTCATCTCGAGATGACTGGCATCTATATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-383s1c1
Sequence:CCGGCTGGAGAATGTCGGCTAGAAACTCGAGTTTCTAGCCGACATTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-274s1c1
Sequence:CCGGGTGACCATAACTCTGCCAAATCTCGAGATTTGGCAGAGTTATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-203s1c1
Sequence:CCGGGCTATGACTTCAAACCTGCTTCTCGAGAAGCAGGTTTGAAGTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-704s1c1
Sequence:CCGGGCAAATCCTCTACTTCTGATACTCGAGTATCAGAAGTAGAGGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-815s21c1
Sequence:CCGGGCCTTCTGATGAATACTTTAACTCGAGTTAAAGTATTCATCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-436s21c1
Sequence:CCGGAGAGTTGAAGGAAGCAGTAAACTCGAGTTTACTGCTTCCTTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-300s21c1
Sequence:CCGGAGGTTCAACTCCACCAGTAACCTCGAGGTTACTGGTGGAGTTGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-588s21c1
Sequence:CCGGGAAGGCAGAAGCTAGTCTAATCTCGAGATTAGACTAGCTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018456
EAF2 MISSION shRNA Lentiviral Transduction Particles
ELL associated factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-772s1c1
Sequence:CCGGCCTGATATAGATGCCAGTCATCTCGAGATGACTGGCATCTATATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-383s1c1
Sequence:CCGGCTGGAGAATGTCGGCTAGAAACTCGAGTTTCTAGCCGACATTCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-274s1c1
Sequence:CCGGGTGACCATAACTCTGCCAAATCTCGAGATTTGGCAGAGTTATGGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-203s1c1
Sequence:CCGGGCTATGACTTCAAACCTGCTTCTCGAGAAGCAGGTTTGAAGTCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018456.4-704s1c1
Sequence:CCGGGCAAATCCTCTACTTCTGATACTCGAGTATCAGAAGTAGAGGATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-815s21c1
Sequence:CCGGGCCTTCTGATGAATACTTTAACTCGAGTTAAAGTATTCATCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-436s21c1
Sequence:CCGGAGAGTTGAAGGAAGCAGTAAACTCGAGTTTACTGCTTCCTTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-300s21c1
Sequence:CCGGAGGTTCAACTCCACCAGTAACCTCGAGGTTACTGGTGGAGTTGAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018456.4-588s21c1
Sequence:CCGGGAAGGCAGAAGCTAGTCTAATCTCGAGATTAGACTAGCTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks