EMAIL THIS PAGE TO A FRIEND

EAPP

E2F-associated phosphoprotein

60 Gene Product Result for
Synonyms: BM036 C14orf11
UniProtKB ID: Q56P03, Q9BVF4, Q9NWV5, Q9NZ86
Gene ID:
Human(55837) Summary: This gene encodes a phosphoprotein that interacts with several members of the E2F family of proteins. The protein localizes to the nucleus, and is present throughout the cell cycle except during mitosis. It functions to modulate E2F-regulated transcription and stimulate proliferation. [provided by RefSeq, Jul 2008]
Mouse(66266) E2F-associated phosphoprotein
Rat(299043) E2F-associated phosphoprotein
Zebrafish(327318) e2f-associated phosphoprotein
chicken(423319) E2F-associated phosphoprotein
dog(490647) E2F-associated phosphoprotein
domestic cat(101089017) E2F-associated phosphoprotein
cow(520143) E2F-associated phosphoprotein
domestic guinea pig(100726666) E2F-associated phosphoprotein
naked mole-rat(101706358) E2F-associated phosphoprotein
sheep(101117880) E2F-associated phosphoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018453 Rosetta Predictions human pricing
NM_001106729 Rosetta Predictions rat pricing
NM_001134987 Rosetta Predictions rat pricing
NM_025456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158156 predicted 741
2 SASI_Hs02_00351997 predicted 716
3 SASI_Hs02_00351998 predicted 713
4 SASI_Hs01_00158157 predicted 236
5 SASI_Hs01_00158158 predicted 902
6 SASI_Hs01_00158160 predicted 723
7 SASI_Hs01_00158162 predicted 894
8 SASI_Hs01_00158163 predicted 807
9 SASI_Hs01_00158165 predicted 851
10 SASI_Hs02_00351999 predicted 701
11 SASI_Hs01_00158159 predicted 762
12 SASI_Hs01_00158161 predicted 738
13 SASI_Hs01_00158164 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221818 predicted 229
2 SASI_Rn02_00221819 predicted 245
3 SASI_Rn02_00221820 predicted 228
4 SASI_Rn02_00221821 predicted 242
5 SASI_Rn02_00221822 predicted 229
6 SASI_Rn02_00221823 predicted 158
7 SASI_Rn02_00221824 predicted 435
8 SASI_Rn02_00221825 predicted 277
9 SASI_Rn02_00221826 predicted 431
10 SASI_Rn02_00221827 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259274 predicted 863
2 SASI_Rn02_00259275 predicted 654
3 SASI_Rn02_00259276 predicted 826
4 SASI_Rn02_00259277 predicted 479
5 SASI_Rn02_00259278 predicted 688
6 SASI_Rn02_00259279 predicted 672
7 SASI_Rn02_00259280 predicted 680
8 SASI_Rn02_00259281 predicted 869
9 SASI_Rn02_00259282 predicted 258
10 SASI_Rn02_00259283 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025954 predicted 298
2 SASI_Mm01_00025955 predicted 291
3 SASI_Mm01_00025956 predicted 333
4 SASI_Mm01_00025957 predicted 274
5 SASI_Mm01_00025958 predicted 467
6 SASI_Mm01_00025959 predicted 573
7 SASI_Mm01_00025960 predicted 240
8 SASI_Mm01_00025961 predicted 355
9 SASI_Mm01_00025963 predicted 452
10 SASI_Mm02_00328292 predicted 313
11 SASI_Mm01_00025962 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025456
EAPP MISSION shRNA Bacterial Glycerol Stock
E2F-associated phosphoprotein
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-230s21c1
Sequence:CCGGCTGGAGAAAGTGAGTCATCAACTCGAGTTGATGACTCACTTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.3-245s1c1
Sequence:CCGGCATCAAGTGAAGATGAATTTGCTCGAGCAAATTCATCTTCACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-160s21c1
Sequence:CCGGGAAGATGAACTGGATGTGCTTCTCGAGAAGCACATCCAGTTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025456.3-986s21c1
Sequence:CCGGCCTCTTTCCTATTCATATCATCTCGAGATGATATGAATAGGAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-660s21c1
Sequence:CCGGGCATGAATCCTACAAGACGCACTCGAGTGCGTCTTGTAGGATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.2-487s1c1
Sequence:CCGGCACAGGATTCCAACAAACGATCTCGAGATCGTTTGTTGGAATCCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.2-797s1c1
Sequence:CCGGGTGCTAAGAAGATGAGGTCTACTCGAGTAGACCTCATCTTCTTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-187s1c1
Sequence:CCGGGAAGATGAACTGGATGTGCTTCTCGAGAAGCACATCCAGTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-687s1c1
Sequence:CCGGGCATGAATCCTACAAGACGCACTCGAGTGCGTCTTGTAGGATTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025456.2-1013s1c1
Sequence:CCGGCCTCTTTCCTATTCATATCATCTCGAGATGATATGAATAGGAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-257s1c1
Sequence:CCGGCTGGAGAAAGTGAGTCATCAACTCGAGTTGATGACTCACTTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025456
EAPP MISSION shRNA shRNA Plasmid DNA
E2F-associated phosphoprotein
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-230s21c1
Sequence:CCGGCTGGAGAAAGTGAGTCATCAACTCGAGTTGATGACTCACTTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.3-245s1c1
Sequence:CCGGCATCAAGTGAAGATGAATTTGCTCGAGCAAATTCATCTTCACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-160s21c1
Sequence:CCGGGAAGATGAACTGGATGTGCTTCTCGAGAAGCACATCCAGTTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025456.3-986s21c1
Sequence:CCGGCCTCTTTCCTATTCATATCATCTCGAGATGATATGAATAGGAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-660s21c1
Sequence:CCGGGCATGAATCCTACAAGACGCACTCGAGTGCGTCTTGTAGGATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.2-487s1c1
Sequence:CCGGCACAGGATTCCAACAAACGATCTCGAGATCGTTTGTTGGAATCCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.2-797s1c1
Sequence:CCGGGTGCTAAGAAGATGAGGTCTACTCGAGTAGACCTCATCTTCTTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-187s1c1
Sequence:CCGGGAAGATGAACTGGATGTGCTTCTCGAGAAGCACATCCAGTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-687s1c1
Sequence:CCGGGCATGAATCCTACAAGACGCACTCGAGTGCGTCTTGTAGGATTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025456.2-1013s1c1
Sequence:CCGGCCTCTTTCCTATTCATATCATCTCGAGATGATATGAATAGGAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-257s1c1
Sequence:CCGGCTGGAGAAAGTGAGTCATCAACTCGAGTTGATGACTCACTTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025456
EAPP MISSION shRNA Lentiviral Transduction Particles
E2F-associated phosphoprotein
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-230s21c1
Sequence:CCGGCTGGAGAAAGTGAGTCATCAACTCGAGTTGATGACTCACTTTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.3-245s1c1
Sequence:CCGGCATCAAGTGAAGATGAATTTGCTCGAGCAAATTCATCTTCACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-160s21c1
Sequence:CCGGGAAGATGAACTGGATGTGCTTCTCGAGAAGCACATCCAGTTCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025456.3-986s21c1
Sequence:CCGGCCTCTTTCCTATTCATATCATCTCGAGATGATATGAATAGGAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025456.3-660s21c1
Sequence:CCGGGCATGAATCCTACAAGACGCACTCGAGTGCGTCTTGTAGGATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.2-487s1c1
Sequence:CCGGCACAGGATTCCAACAAACGATCTCGAGATCGTTTGTTGGAATCCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025456.2-797s1c1
Sequence:CCGGGTGCTAAGAAGATGAGGTCTACTCGAGTAGACCTCATCTTCTTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-187s1c1
Sequence:CCGGGAAGATGAACTGGATGTGCTTCTCGAGAAGCACATCCAGTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-687s1c1
Sequence:CCGGGCATGAATCCTACAAGACGCACTCGAGTGCGTCTTGTAGGATTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025456.2-1013s1c1
Sequence:CCGGCCTCTTTCCTATTCATATCATCTCGAGATGATATGAATAGGAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025456.2-257s1c1
Sequence:CCGGCTGGAGAAAGTGAGTCATCAACTCGAGTTGATGACTCACTTTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018453
VALIDATED
EAPP MISSION shRNA Bacterial Glycerol Stock
E2F-associated phosphoprotein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-384s1c1
Sequence:CCGGCGACAAGGTACTACGATGATACTCGAGTATCATCGTAGTACCTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-228s1c1
Sequence:CCGGGAGAATGTCTTACCGGAGAAACTCGAGTTTCTCCGGTAAGACATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-894s1c1
Sequence:CCGGGCAGTCTACGACAAGGATGAACTCGAGTTCATCCTTGTCGTAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-647s1c1
Sequence:CCGGGACCACACTCTTGCCTTGATTCTCGAGAATCAAGGCAAGAGTGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-831s1c1
Sequence:CCGGGCAGAGACAGATGTGGAAGAACTCGAGTTCTTCCACATCTGTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-440s1c1
Sequence:CCGGGCAGTACAGGTGACCAAGAAACTCGAGTTTCTTGGTCACCTGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-578s1c1
Sequence:CCGGCCACAGAGATCACGTCAACAACTCGAGTTGTTGACGTGATCTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-626s1c1
Sequence:CCGGCTTGAATTGTCCTGCCTGCATCTCGAGATGCAGGCAGGACAATTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-425s1c1
Sequence:CCGGGAGGATGAAGACAGAGCAGTACTCGAGTACTGCTCTGTCTTCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018453.2-342s1c1
Sequence:CCGGGAACTGGATCTTCCTCAGGAACTCGAGTTCCTGAGGAAGATCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-668s1c1
Sequence:CCGGGCCAAAGGCATGAATCATACACTCGAGTGTATGATTCATGCCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-599s1c1
Sequence:CCGGCAGCCTGTTCCAAATAGTGATCTCGAGATCACTATTTGGAACAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018453
VALIDATED
EAPP MISSION shRNA shRNA Plasmid DNA
E2F-associated phosphoprotein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-384s1c1
Sequence:CCGGCGACAAGGTACTACGATGATACTCGAGTATCATCGTAGTACCTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-228s1c1
Sequence:CCGGGAGAATGTCTTACCGGAGAAACTCGAGTTTCTCCGGTAAGACATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-894s1c1
Sequence:CCGGGCAGTCTACGACAAGGATGAACTCGAGTTCATCCTTGTCGTAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-647s1c1
Sequence:CCGGGACCACACTCTTGCCTTGATTCTCGAGAATCAAGGCAAGAGTGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-831s1c1
Sequence:CCGGGCAGAGACAGATGTGGAAGAACTCGAGTTCTTCCACATCTGTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-440s1c1
Sequence:CCGGGCAGTACAGGTGACCAAGAAACTCGAGTTTCTTGGTCACCTGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-578s1c1
Sequence:CCGGCCACAGAGATCACGTCAACAACTCGAGTTGTTGACGTGATCTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-626s1c1
Sequence:CCGGCTTGAATTGTCCTGCCTGCATCTCGAGATGCAGGCAGGACAATTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-425s1c1
Sequence:CCGGGAGGATGAAGACAGAGCAGTACTCGAGTACTGCTCTGTCTTCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018453.2-342s1c1
Sequence:CCGGGAACTGGATCTTCCTCAGGAACTCGAGTTCCTGAGGAAGATCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-668s1c1
Sequence:CCGGGCCAAAGGCATGAATCATACACTCGAGTGTATGATTCATGCCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-599s1c1
Sequence:CCGGCAGCCTGTTCCAAATAGTGATCTCGAGATCACTATTTGGAACAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018453
VALIDATED
EAPP MISSION shRNA Lentiviral Transduction Particles
E2F-associated phosphoprotein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-384s1c1
Sequence:CCGGCGACAAGGTACTACGATGATACTCGAGTATCATCGTAGTACCTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-228s1c1
Sequence:CCGGGAGAATGTCTTACCGGAGAAACTCGAGTTTCTCCGGTAAGACATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140879    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-894s1c1
Sequence:CCGGGCAGTCTACGACAAGGATGAACTCGAGTTCATCCTTGTCGTAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-647s1c1
Sequence:CCGGGACCACACTCTTGCCTTGATTCTCGAGAATCAAGGCAAGAGTGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-831s1c1
Sequence:CCGGGCAGAGACAGATGTGGAAGAACTCGAGTTCTTCCACATCTGTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-440s1c1
Sequence:CCGGGCAGTACAGGTGACCAAGAAACTCGAGTTTCTTGGTCACCTGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018453.2-578s1c1
Sequence:CCGGCCACAGAGATCACGTCAACAACTCGAGTTGTTGACGTGATCTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-626s1c1
Sequence:CCGGCTTGAATTGTCCTGCCTGCATCTCGAGATGCAGGCAGGACAATTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-425s1c1
Sequence:CCGGGAGGATGAAGACAGAGCAGTACTCGAGTACTGCTCTGTCTTCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018453.2-342s1c1
Sequence:CCGGGAACTGGATCTTCCTCAGGAACTCGAGTTCCTGAGGAAGATCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-668s1c1
Sequence:CCGGGCCAAAGGCATGAATCATACACTCGAGTGTATGATTCATGCCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018453.2-599s1c1
Sequence:CCGGCAGCCTGTTCCAAATAGTGATCTCGAGATCACTATTTGGAACAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)