EMAIL THIS PAGE TO A FRIEND

EARS2

glutamyl-tRNA synthetase 2, mitochondrial

70 Gene Product Result for
Synonyms: COXPD12 MSE1
UniProtKB ID: Q5JPH6, B3KTT2, D3DWF1, Q8TF31
Gene ID:
Human(124454) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene belongs to the class-I aminoacyl-tRNA synthetase family and catalyzes the attachment of glutamate to tRNA(Glu). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Mouse(67417) glutamyl-tRNA synthetase 2 (mitochondrial)(putative)
Rat(361641) glutamyl-tRNA synthetase 2, mitochondrial
chicken(427672) glutamyl-tRNA synthetase 2, mitochondrial (putative)
dog(479807) glutamyl-tRNA synthetase 2, mitochondrial
Horse(100069049) glutamyl-tRNA synthetase 2, mitochondrial
cow(100300732) glutamyl-tRNA synthetase 2, mitochondrial
domestic cat(101099263) glutamyl-tRNA synthetase 2, mitochondrial
sheep(101117387) glutamyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100720917) glutamyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101718595) glutamyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083614 Rosetta Predictions human pricing
NM_133451 Rosetta Predictions human pricing
NR_003501 Rosetta Predictions human pricing
XM_341920 Rosetta Predictions rat pricing
NM_026140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317131 predicted 1458
2 SASI_Hs02_00317132 predicted 238
3 SASI_Hs02_00317133 predicted 1515
4 SASI_Hs02_00317134 predicted 194
5 SASI_Hs02_00317135 predicted 612
6 SASI_Hs02_00317136 predicted 679
7 SASI_Hs02_00317137 predicted 316
8 SASI_Hs02_00317138 predicted 1391
9 SASI_Hs02_00317139 predicted 1227
10 SASI_Hs02_00317140 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074723 predicted 1613
2 SASI_Hs01_00074724 predicted 1610
3 SASI_Hs01_00074725 predicted 1441
4 SASI_Hs01_00074726 predicted 1379
5 SASI_Hs01_00074727 predicted 213
6 SASI_Hs01_00074728 predicted 1492
7 SASI_Hs01_00074729 predicted 1495
8 SASI_Hs01_00074730 predicted 659
9 SASI_Hs01_00074731 predicted 1375
10 SASI_Hs01_00074732 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379307 predicted 1464
2 SASI_Hs02_00379308 predicted 232
3 SASI_Hs02_00379309 predicted 1511
4 SASI_Hs02_00379310 predicted 3611
5 SASI_Hs02_00379311 predicted 616
6 SASI_Hs02_00379312 predicted 674
7 SASI_Hs02_00379313 predicted 320
8 SASI_Hs02_00379314 predicted 1393
9 SASI_Hs02_00379315 predicted 1229
10 SASI_Hs02_00379316 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393563 predicted 725
2 SASI_Rn02_00393564 predicted 1593
3 SASI_Rn02_00393565 predicted 622
4 SASI_Rn02_00393566 predicted 1360
5 SASI_Rn02_00393567 predicted 1478
6 SASI_Rn02_00393568 predicted 1218
7 SASI_Rn02_00393569 predicted 235
8 SASI_Rn02_00393570 predicted 197
9 SASI_Rn02_00393571 predicted 332
10 SASI_Rn02_00393572 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027413 predicted 1383
2 SASI_Mm01_00027414 predicted 696
3 SASI_Mm01_00027415 predicted 428
4 SASI_Mm01_00027416 predicted 1062
5 SASI_Mm01_00027417 predicted 1569
6 SASI_Mm01_00027418 predicted 1190
7 SASI_Mm02_00329748 predicted 774
8 SASI_Mm01_00027419 predicted 1163
9 SASI_Mm01_00027420 predicted 585
10 SASI_Mm01_00027421 predicted 860
11 SASI_Mm01_00027422 predicted 1584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133451
VALIDATED
EARS2 MISSION shRNA Bacterial Glycerol Stock
glutamyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-919s1c1
Sequence:CCGGCCGATTCCTTGTTGGACATCACTCGAGTGATGTCCAACAAGGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133451.1-173s1c1
Sequence:CCGGCACTGCCTTGTACAACTACATCTCGAGATGTAGTTGTACAAGGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133451.1-1936s1c1
Sequence:CCGGCCACAGAACCAGGTGGTTTAACTCGAGTTAAACCACCTGGTTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133451.1-3425s1c1
Sequence:CCGGGCCAATCTTGTCTGAGTTCTTCTCGAGAAGAACTCAGACAAGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_133451.1-1384s1c1
Sequence:CCGGGCTTAACTCAGGATATGCTGACTCGAGTCAGCATATCCTGAGTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_133451.1-1392s1c1
Sequence:CCGGCAGGATATGCTGAATGGAGAACTCGAGTTCTCCATTCAGCATATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133451.1-1361s1c1
Sequence:CCGGGCTTCTAGAAAGATCTGGTATCTCGAGATACCAGATCTTTCTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-1410s1c1
Sequence:CCGGGAACTGAAGAAGCTATCAGAACTCGAGTTCTGATAGCTTCTTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-1444s1c1
Sequence:CCGGCCAAGTACAGTAATGTGATGACTCGAGTCATCACATTACTGTACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_133451.1-1437s1c1
Sequence:CCGGGAAGGCACCAAGTACAGTAATCTCGAGATTACTGTACTTGGTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133451
VALIDATED
EARS2 MISSION shRNA shRNA Plasmid DNA
glutamyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-919s1c1
Sequence:CCGGCCGATTCCTTGTTGGACATCACTCGAGTGATGTCCAACAAGGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133451.1-173s1c1
Sequence:CCGGCACTGCCTTGTACAACTACATCTCGAGATGTAGTTGTACAAGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133451.1-1936s1c1
Sequence:CCGGCCACAGAACCAGGTGGTTTAACTCGAGTTAAACCACCTGGTTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133451.1-3425s1c1
Sequence:CCGGGCCAATCTTGTCTGAGTTCTTCTCGAGAAGAACTCAGACAAGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_133451.1-1384s1c1
Sequence:CCGGGCTTAACTCAGGATATGCTGACTCGAGTCAGCATATCCTGAGTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_133451.1-1392s1c1
Sequence:CCGGCAGGATATGCTGAATGGAGAACTCGAGTTCTCCATTCAGCATATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133451.1-1361s1c1
Sequence:CCGGGCTTCTAGAAAGATCTGGTATCTCGAGATACCAGATCTTTCTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-1410s1c1
Sequence:CCGGGAACTGAAGAAGCTATCAGAACTCGAGTTCTGATAGCTTCTTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-1444s1c1
Sequence:CCGGCCAAGTACAGTAATGTGATGACTCGAGTCATCACATTACTGTACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_133451.1-1437s1c1
Sequence:CCGGGAAGGCACCAAGTACAGTAATCTCGAGATTACTGTACTTGGTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133451
VALIDATED
EARS2 MISSION shRNA Lentiviral Transduction Particles
glutamyl-tRNA synthetase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-919s1c1
Sequence:CCGGCCGATTCCTTGTTGGACATCACTCGAGTGATGTCCAACAAGGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133451.1-173s1c1
Sequence:CCGGCACTGCCTTGTACAACTACATCTCGAGATGTAGTTGTACAAGGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133451.1-1936s1c1
Sequence:CCGGCCACAGAACCAGGTGGTTTAACTCGAGTTAAACCACCTGGTTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133451.1-3425s1c1
Sequence:CCGGGCCAATCTTGTCTGAGTTCTTCTCGAGAAGAACTCAGACAAGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_133451.1-1384s1c1
Sequence:CCGGGCTTAACTCAGGATATGCTGACTCGAGTCAGCATATCCTGAGTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_133451.1-1392s1c1
Sequence:CCGGCAGGATATGCTGAATGGAGAACTCGAGTTCTCCATTCAGCATATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133451.1-1361s1c1
Sequence:CCGGGCTTCTAGAAAGATCTGGTATCTCGAGATACCAGATCTTTCTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-1410s1c1
Sequence:CCGGGAACTGAAGAAGCTATCAGAACTCGAGTTCTGATAGCTTCTTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133451.1-1444s1c1
Sequence:CCGGCCAAGTACAGTAATGTGATGACTCGAGTCATCACATTACTGTACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_133451.1-1437s1c1
Sequence:CCGGGAAGGCACCAAGTACAGTAATCTCGAGATTACTGTACTTGGTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026140
VALIDATED
EARS2 MISSION shRNA Bacterial Glycerol Stock
glutamyl-tRNA synthetase 2, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026140.2-1617s1c1
Sequence:CCGGGATGACCATGAGAGCCTCTAACTCGAGTTAGAGGCTCTCATGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1567s1c1
Sequence:CCGGGAATCCAGAAGGTGCTTTCTACTCGAGTAGAAAGCACCTTCTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1196s21c1
Sequence:CCGGTGTTCTGGACCCTGCATATATCTCGAGATATATGCAGGGTCCAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1563s21c1
Sequence:CCGGGAACGAATCCAGAAGGTGCTTCTCGAGAAGCACCTTCTGGATTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026140.2-1618s21c1
Sequence:CCGGATGACCATGAGAGCCTCTAACCTCGAGGTTAGAGGCTCTCATGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1563s1c1
Sequence:CCGGGAACGAATCCAGAAGGTGCTTCTCGAGAAGCACCTTCTGGATTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1549s1c1
Sequence:CCGGCAAAGGAAGTACGGGAACGAACTCGAGTTCGTTCCCGTACTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1549s21c1
Sequence:CCGGCAAAGGAAGTACGGGAACGAACTCGAGTTCGTTCCCGTACTTCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-609s21c1
Sequence:CCGGGCCTTCCAGGACCTGGTATATCTCGAGATATACCAGGTCCTGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026140
VALIDATED
EARS2 MISSION shRNA shRNA Plasmid DNA
glutamyl-tRNA synthetase 2, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026140.2-1617s1c1
Sequence:CCGGGATGACCATGAGAGCCTCTAACTCGAGTTAGAGGCTCTCATGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1567s1c1
Sequence:CCGGGAATCCAGAAGGTGCTTTCTACTCGAGTAGAAAGCACCTTCTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1196s21c1
Sequence:CCGGTGTTCTGGACCCTGCATATATCTCGAGATATATGCAGGGTCCAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1563s21c1
Sequence:CCGGGAACGAATCCAGAAGGTGCTTCTCGAGAAGCACCTTCTGGATTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026140.2-1618s21c1
Sequence:CCGGATGACCATGAGAGCCTCTAACCTCGAGGTTAGAGGCTCTCATGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1563s1c1
Sequence:CCGGGAACGAATCCAGAAGGTGCTTCTCGAGAAGCACCTTCTGGATTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1549s1c1
Sequence:CCGGCAAAGGAAGTACGGGAACGAACTCGAGTTCGTTCCCGTACTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1549s21c1
Sequence:CCGGCAAAGGAAGTACGGGAACGAACTCGAGTTCGTTCCCGTACTTCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-609s21c1
Sequence:CCGGGCCTTCCAGGACCTGGTATATCTCGAGATATACCAGGTCCTGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026140
VALIDATED
EARS2 MISSION shRNA Lentiviral Transduction Particles
glutamyl-tRNA synthetase 2, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026140.2-1617s1c1
Sequence:CCGGGATGACCATGAGAGCCTCTAACTCGAGTTAGAGGCTCTCATGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1567s1c1
Sequence:CCGGGAATCCAGAAGGTGCTTTCTACTCGAGTAGAAAGCACCTTCTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1196s21c1
Sequence:CCGGTGTTCTGGACCCTGCATATATCTCGAGATATATGCAGGGTCCAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1563s21c1
Sequence:CCGGGAACGAATCCAGAAGGTGCTTCTCGAGAAGCACCTTCTGGATTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026140.2-1618s21c1
Sequence:CCGGATGACCATGAGAGCCTCTAACCTCGAGGTTAGAGGCTCTCATGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1563s1c1
Sequence:CCGGGAACGAATCCAGAAGGTGCTTCTCGAGAAGCACCTTCTGGATTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026140.2-1549s1c1
Sequence:CCGGCAAAGGAAGTACGGGAACGAACTCGAGTTCGTTCCCGTACTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-1549s21c1
Sequence:CCGGCAAAGGAAGTACGGGAACGAACTCGAGTTCGTTCCCGTACTTCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026140.2-609s21c1
Sequence:CCGGGCCTTCCAGGACCTGGTATATCTCGAGATATACCAGGTCCTGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)