EMAIL THIS PAGE TO A FRIEND

EBAG9

estrogen receptor binding site associated, antigen, 9

100 Gene Product Result for
Synonyms: EB9 PDAF
UniProtKB ID: O00559, Q6IB20, Q9BS76
Gene ID:
Human(9166) Summary: This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10. [provided by RefSeq, Jul 2013]
Mouse(55960) estrogen receptor-binding fragment-associated gene 9
Rat(299864) estrogen receptor binding site associated, antigen, 9
Zebrafish(394069) estrogen receptor binding site associated, antigen, 9
chicken(420276) estrogen receptor binding site associated, antigen, 9
cow(538551) estrogen receptor binding site associated, antigen, 9
domestic cat(101090232) estrogen receptor binding site associated, antigen, 9
dog(403500) estrogen receptor binding site associated, antigen, 9
domestic guinea pig(100724163) estrogen receptor binding site associated, antigen, 9
naked mole-rat(101725035) estrogen receptor binding site associated, antigen, 9
sheep(101117425) estrogen receptor binding site associated, antigen, 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004215 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004215 Rosetta Predictions human pricing
NM_198120 Rosetta Predictions human pricing
NM_001009665 Rosetta Predictions rat pricing
NM_019480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147083 predicted 684
2 SASI_Hs01_00147084 predicted 585
3 SASI_Hs02_00337125 predicted 904
4 SASI_Hs01_00147085 predicted 617
5 SASI_Hs01_00147086 predicted 763
6 SASI_Hs01_00147087 predicted 822
7 SASI_Hs01_00147088 predicted 754
8 SASI_Hs01_00147090 predicted 792
9 SASI_Hs01_00147091 predicted 911
10 SASI_Hs02_00337126 predicted 839
11 SASI_Hs01_00147082 predicted 927
12 SASI_Hs01_00147089 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025808 predicted 517
2 SASI_Hs01_00025809 predicted 429
3 SASI_Hs02_00371652 predicted 742
4 SASI_Hs01_00025810 predicted 456
5 SASI_Hs01_00025811 predicted 598
6 SASI_Hs01_00025812 predicted 663
7 SASI_Hs01_00025813 predicted 593
8 SASI_Hs01_00025815 predicted 628
9 SASI_Hs01_00025816 predicted 750
10 SASI_Hs02_00371653 predicted 671
11 SASI_Hs01_00025807 predicted 767
12 SASI_Hs01_00025814 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102145 predicted 391
2 SASI_Rn01_00102146 predicted 826
3 SASI_Rn01_00102147 predicted 962
4 SASI_Rn01_00102148 predicted 949
5 SASI_Rn01_00102149 predicted 647
6 SASI_Rn01_00102150 predicted 212
7 SASI_Rn01_00102151 predicted 1083
8 SASI_Rn01_00102152 predicted 1005
9 SASI_Rn02_00199698 predicted 1057
10 SASI_Rn01_00102153 predicted 983
11 SASI_Rn01_00102154 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167470 predicted 941
2 SASI_Mm02_00324480 predicted 756
3 SASI_Mm02_00324481 predicted 1191
4 SASI_Mm02_00324482 predicted 1106
5 SASI_Mm02_00324483 predicted 814
6 SASI_Mm02_00324484 predicted 1257
7 SASI_Mm02_00324485 predicted 1095
8 SASI_Mm01_00167476 predicted 1027
9 SASI_Mm02_00324486 predicted 1228
10 SASI_Mm02_00324487 predicted 1019
11 SASI_Mm01_00167471 predicted 512
12 SASI_Mm01_00167472 predicted 350
13 SASI_Mm01_00167473 predicted 750
14 SASI_Mm01_00167474 predicted 324
15 SASI_Mm01_00167475 predicted 757
16 SASI_Mm01_00167477 predicted 708
17 SASI_Mm01_00167478 predicted 1046
18 SASI_Mm01_00167479 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019480
VALIDATED
EBAG9 MISSION shRNA Bacterial Glycerol Stock
estrogen receptor binding site associated, antigen, 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-519s21c1
Sequence:CCGGCCCACAAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-371s21c1
Sequence:CCGGGTTCTCGTTCCTAAAGAGATTCTCGAGAATCTCTTTAGGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-602s21c1
Sequence:CCGGCAAGGACATGACACCAACTATCTCGAGATAGTTGGTGTCATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-363s21c1
Sequence:CCGGGCAACAGTGTTCTCGTTCCTACTCGAGTAGGAACGAGAACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-523s1c1
Sequence:CCGGCCCACAAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019480.3-375s1c1
Sequence:CCGGGTTCTCGTTCCTAAAGAGATTCTCGAGAATCTCTTTAGGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-606s1c1
Sequence:CCGGCAAGGACATGACACCAACTATCTCGAGATAGTTGGTGTCATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-367s1c1
Sequence:CCGGGCAACAGTGTTCTCGTTCCTACTCGAGTAGGAACGAGAACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019480
VALIDATED
EBAG9 MISSION shRNA shRNA Plasmid DNA
estrogen receptor binding site associated, antigen, 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-519s21c1
Sequence:CCGGCCCACAAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-371s21c1
Sequence:CCGGGTTCTCGTTCCTAAAGAGATTCTCGAGAATCTCTTTAGGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-602s21c1
Sequence:CCGGCAAGGACATGACACCAACTATCTCGAGATAGTTGGTGTCATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-363s21c1
Sequence:CCGGGCAACAGTGTTCTCGTTCCTACTCGAGTAGGAACGAGAACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-523s1c1
Sequence:CCGGCCCACAAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019480.3-375s1c1
Sequence:CCGGGTTCTCGTTCCTAAAGAGATTCTCGAGAATCTCTTTAGGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-606s1c1
Sequence:CCGGCAAGGACATGACACCAACTATCTCGAGATAGTTGGTGTCATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-367s1c1
Sequence:CCGGGCAACAGTGTTCTCGTTCCTACTCGAGTAGGAACGAGAACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019480
VALIDATED
EBAG9 MISSION shRNA Lentiviral Transduction Particles
estrogen receptor binding site associated, antigen, 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-519s21c1
Sequence:CCGGCCCACAAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-371s21c1
Sequence:CCGGGTTCTCGTTCCTAAAGAGATTCTCGAGAATCTCTTTAGGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-602s21c1
Sequence:CCGGCAAGGACATGACACCAACTATCTCGAGATAGTTGGTGTCATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019480.4-363s21c1
Sequence:CCGGGCAACAGTGTTCTCGTTCCTACTCGAGTAGGAACGAGAACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-523s1c1
Sequence:CCGGCCCACAAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019480.3-375s1c1
Sequence:CCGGGTTCTCGTTCCTAAAGAGATTCTCGAGAATCTCTTTAGGAACGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-606s1c1
Sequence:CCGGCAAGGACATGACACCAACTATCTCGAGATAGTTGGTGTCATGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019480.3-367s1c1
Sequence:CCGGGCAACAGTGTTCTCGTTCCTACTCGAGTAGGAACGAGAACACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004215
VALIDATED
EBAG9 MISSION shRNA Bacterial Glycerol Stock
estrogen receptor binding site associated, antigen, 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004215.3-437s21c1
Sequence:CCGGGCCTAGCAACAGTATTCTCATCTCGAGATGAGAATACTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004215.3-767s21c1
Sequence:CCGGGCACAGGTTTCTCTAGTAGATCTCGAGATCTACTAGAGAAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004215.3-1092s21c1
Sequence:CCGGAGCAACATTTGTATGGATTTACTCGAGTAAATCCATACAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004215.3-952s21c1
Sequence:CCGGGCCGAACAACAAAGGAAGAAACTCGAGTTTCTTCCTTTGTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004215.3-683s21c1
Sequence:CCGGAGGACATGACACCAACTATTACTCGAGTAATAGTTGGTGTCATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-437s1c1
Sequence:CCGGGCCTAGCAACAGTATTCTCATCTCGAGATGAGAATACTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004215.3-598s1c1
Sequence:CCGGCCCACCAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-952s1c1
Sequence:CCGGGCCGAACAACAAAGGAAGAAACTCGAGTTTCTTCCTTTGTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-767s1c1
Sequence:CCGGGCACAGGTTTCTCTAGTAGATCTCGAGATCTACTAGAGAAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004215.3-493s1c1
Sequence:CCGGCGGAAATTAAGTGGAGACCAACTCGAGTTGGTCTCCACTTAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004215
VALIDATED
EBAG9 MISSION shRNA shRNA Plasmid DNA
estrogen receptor binding site associated, antigen, 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004215.3-437s21c1
Sequence:CCGGGCCTAGCAACAGTATTCTCATCTCGAGATGAGAATACTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004215.3-767s21c1
Sequence:CCGGGCACAGGTTTCTCTAGTAGATCTCGAGATCTACTAGAGAAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004215.3-1092s21c1
Sequence:CCGGAGCAACATTTGTATGGATTTACTCGAGTAAATCCATACAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004215.3-952s21c1
Sequence:CCGGGCCGAACAACAAAGGAAGAAACTCGAGTTTCTTCCTTTGTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004215.3-683s21c1
Sequence:CCGGAGGACATGACACCAACTATTACTCGAGTAATAGTTGGTGTCATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-437s1c1
Sequence:CCGGGCCTAGCAACAGTATTCTCATCTCGAGATGAGAATACTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004215.3-598s1c1
Sequence:CCGGCCCACCAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-952s1c1
Sequence:CCGGGCCGAACAACAAAGGAAGAAACTCGAGTTTCTTCCTTTGTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-767s1c1
Sequence:CCGGGCACAGGTTTCTCTAGTAGATCTCGAGATCTACTAGAGAAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004215.3-493s1c1
Sequence:CCGGCGGAAATTAAGTGGAGACCAACTCGAGTTGGTCTCCACTTAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004215
VALIDATED
EBAG9 MISSION shRNA Lentiviral Transduction Particles
estrogen receptor binding site associated, antigen, 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004215.3-437s21c1
Sequence:CCGGGCCTAGCAACAGTATTCTCATCTCGAGATGAGAATACTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004215.3-767s21c1
Sequence:CCGGGCACAGGTTTCTCTAGTAGATCTCGAGATCTACTAGAGAAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004215.3-1092s21c1
Sequence:CCGGAGCAACATTTGTATGGATTTACTCGAGTAAATCCATACAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004215.3-952s21c1
Sequence:CCGGGCCGAACAACAAAGGAAGAAACTCGAGTTTCTTCCTTTGTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004215.3-683s21c1
Sequence:CCGGAGGACATGACACCAACTATTACTCGAGTAATAGTTGGTGTCATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-437s1c1
Sequence:CCGGGCCTAGCAACAGTATTCTCATCTCGAGATGAGAATACTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004215.3-598s1c1
Sequence:CCGGCCCACCAGTGTAAAGATCGAACTCGAGTTCGATCTTTACACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-952s1c1
Sequence:CCGGGCCGAACAACAAAGGAAGAAACTCGAGTTTCTTCCTTTGTTGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004215.3-767s1c1
Sequence:CCGGGCACAGGTTTCTCTAGTAGATCTCGAGATCTACTAGAGAAACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004215.3-493s1c1
Sequence:CCGGCGGAAATTAAGTGGAGACCAACTCGAGTTGGTCTCCACTTAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks