EMAIL THIS PAGE TO A FRIEND

EBF1

early B-cell factor 1

69 Gene Product Result for
Synonyms: COE1 EBF O/E-1 OLF1
UniProtKB ID: Q9UH73, Q8IW11
Gene ID:
Mouse(13591) early B cell factor 1
Rat(116543) early B-cell factor 1
Thale Cress(817087) EIN3-binding F-box protein 1
dog(479312) early B-cell factor 1
cow(537712) early B-cell factor 1
Horse(100059840) early B-cell factor 1
domestic cat(101081441) early B-cell factor 1
chicken(395512) early B-cell factor 1
sheep(101114190) early B-cell factor 1
naked mole-rat(101702802) early B-cell factor 1
domestic guinea pig(100732588) early B-cell factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0077 AQUA Peptide AADIAEALYSVP[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024007 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151831 MISSION® esiRNA esiRNA human EBF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024007 Rosetta Predictions human pricing
NM_053820 Rosetta Predictions rat pricing
NM_007897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240646 predicted 1076
2 SASI_Hs01_00240647 predicted 1627
3 SASI_Hs01_00240648 predicted 2052
4 SASI_Hs01_00240649 predicted 827
5 SASI_Hs01_00240651 predicted 954
6 SASI_Hs01_00240652 predicted 606
7 SASI_Hs01_00240653 predicted 842
8 SASI_Hs01_00240654 predicted 737
9 SASI_Hs02_00356425 predicted 479
10 SASI_Hs01_00240655 predicted 918
11 SASI_Hs01_00240650 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035972 predicted 554
2 SASI_Rn01_00035973 predicted 1439
3 SASI_Rn01_00035974 predicted 475
4 SASI_Rn01_00035975 predicted 1757
5 SASI_Rn01_00035976 predicted 202
6 SASI_Rn02_00266651 predicted 1760
7 SASI_Rn01_00035977 predicted 1332
8 SASI_Rn02_00266652 predicted 1636
9 SASI_Rn02_00266653 predicted 564
10 SASI_Rn02_00266654 predicted 1337
11 SASI_Rn01_00035970 predicted 989
12 SASI_Rn01_00035971 predicted 1381
13 SASI_Rn01_00035978 predicted 1208
14 SASI_Rn01_00035979 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079629 predicted 817
2 SASI_Mm01_00079630 predicted 1794
3 SASI_Mm01_00079631 predicted 566
4 SASI_Mm01_00079632 predicted 212
5 SASI_Mm01_00079633 predicted 1060
6 SASI_Mm01_00079634 predicted 1793
7 SASI_Mm01_00079635 predicted 1677
8 SASI_Mm01_00079636 predicted 1851
9 SASI_Mm01_00079637 predicted 1372
10 SASI_Mm01_00079638 predicted 1866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024007
VALIDATED
EBF1 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-2390s1c1
Sequence:CCGGGCTCTATACAAGGGACACTATCTCGAGATAGTGTCCCTTGTATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-1574s1c1
Sequence:CCGGGCAGGGATGATGGGCGTGAATCTCGAGATTCACGCCCATCATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-695s1c1
Sequence:CCGGGCCATAGTGTATGAAGGCCAACTCGAGTTGGCCTTCATACACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-962s1c1
Sequence:CCGGGCAGTCTCTGATAACATGTTTCTCGAGAAACATGTTATCAGAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-812s1c1
Sequence:CCGGCCCTCAGATCCAGTGATAATTCTCGAGAATTATCACTGGATCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1167s21c1
Sequence:CCGGGATGGGTTACAGGTCATATTCCTCGAGGAATATGACCTGTAACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1345s21c1
Sequence:CCGGACGAACCCACCATCGATTATGCTCGAGCATAATCGATGGTGGGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1942s21c1
Sequence:CCGGACATGGTCTCAGCCGTGAAACCTCGAGGTTTCACGGCTGAGACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024007.3-2369s21c1
Sequence:CCGGAGCTTAATTCTGCAATCATTTCTCGAGAAATGATTGCAGAATTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1132s21c1
Sequence:CCGGGTGCGACTGTGATCATCATAGCTCGAGCTATGATGATCACAGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-2033s21c1
Sequence:CCGGGAACAGCCTGCAAGCGATATCCTCGAGGATATCGCTTGCAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024007
VALIDATED
EBF1 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-2390s1c1
Sequence:CCGGGCTCTATACAAGGGACACTATCTCGAGATAGTGTCCCTTGTATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-1574s1c1
Sequence:CCGGGCAGGGATGATGGGCGTGAATCTCGAGATTCACGCCCATCATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-695s1c1
Sequence:CCGGGCCATAGTGTATGAAGGCCAACTCGAGTTGGCCTTCATACACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-962s1c1
Sequence:CCGGGCAGTCTCTGATAACATGTTTCTCGAGAAACATGTTATCAGAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-812s1c1
Sequence:CCGGCCCTCAGATCCAGTGATAATTCTCGAGAATTATCACTGGATCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1167s21c1
Sequence:CCGGGATGGGTTACAGGTCATATTCCTCGAGGAATATGACCTGTAACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1345s21c1
Sequence:CCGGACGAACCCACCATCGATTATGCTCGAGCATAATCGATGGTGGGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1942s21c1
Sequence:CCGGACATGGTCTCAGCCGTGAAACCTCGAGGTTTCACGGCTGAGACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024007.3-2369s21c1
Sequence:CCGGAGCTTAATTCTGCAATCATTTCTCGAGAAATGATTGCAGAATTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1132s21c1
Sequence:CCGGGTGCGACTGTGATCATCATAGCTCGAGCTATGATGATCACAGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-2033s21c1
Sequence:CCGGGAACAGCCTGCAAGCGATATCCTCGAGGATATCGCTTGCAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024007
VALIDATED
EBF1 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-2390s1c1
Sequence:CCGGGCTCTATACAAGGGACACTATCTCGAGATAGTGTCCCTTGTATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-1574s1c1
Sequence:CCGGGCAGGGATGATGGGCGTGAATCTCGAGATTCACGCCCATCATCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-695s1c1
Sequence:CCGGGCCATAGTGTATGAAGGCCAACTCGAGTTGGCCTTCATACACTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-962s1c1
Sequence:CCGGGCAGTCTCTGATAACATGTTTCTCGAGAAACATGTTATCAGAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024007.2-812s1c1
Sequence:CCGGCCCTCAGATCCAGTGATAATTCTCGAGAATTATCACTGGATCTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1167s21c1
Sequence:CCGGGATGGGTTACAGGTCATATTCCTCGAGGAATATGACCTGTAACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1345s21c1
Sequence:CCGGACGAACCCACCATCGATTATGCTCGAGCATAATCGATGGTGGGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1942s21c1
Sequence:CCGGACATGGTCTCAGCCGTGAAACCTCGAGGTTTCACGGCTGAGACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024007.3-2369s21c1
Sequence:CCGGAGCTTAATTCTGCAATCATTTCTCGAGAAATGATTGCAGAATTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-1132s21c1
Sequence:CCGGGTGCGACTGTGATCATCATAGCTCGAGCTATGATGATCACAGTCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024007.3-2033s21c1
Sequence:CCGGGAACAGCCTGCAAGCGATATCCTCGAGGATATCGCTTGCAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007897
VALIDATED
EBF1 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-1866s1c1
Sequence:CCGGGCTACGAAAGTTATCTGACATCTCGAGATGTCAGATAACTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-720s1c1
Sequence:CCGGCCTGGCAGTCTCTGATAACATCTCGAGATGTTATCAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007897.1-1113s1c1
Sequence:CCGGCCAGAGGTTACAGAAGGTCATCTCGAGATGACCTTCTGTAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007897.1-1470s1c1
Sequence:CCGGCCCACAGCAAACCAACTATAACTCGAGTTATAGTTGGTTTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-486s1c1
Sequence:CCGGCCCTGAAATGTGCCGAGTATTCTCGAGAATACTCGGCACATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-875s21c1
Sequence:CCGGGCGCGACTGTGATCATCATAGCTCGAGCTATGATGATCACAGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007897.2-910s21c1
Sequence:CCGGGATGGGTTACAGGTCATATTCCTCGAGGAATATGACCTGTAACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-1859s21c1
Sequence:CCGGGGATTCTGCTACGAAAGTTATCTCGAGATAACTTTCGTAGCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007897.2-1115s21c1
Sequence:CCGGAGAGGTTACAGAAGGTCATTCCTCGAGGAATGACCTTCTGTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-219s21c1
Sequence:CCGGGCCTTCTAACCTGCGGAAATCCTCGAGGATTTCCGCAGGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-793s21c1
Sequence:CCGGTCGGAAGGTACGCCCTCTTATCTCGAGATAAGAGGGCGTACCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-1921s21c1
Sequence:CCGGTTAAGAGGAATCACACAATAACTCGAGTTATTGTGTGATTCCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007897
VALIDATED
EBF1 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-1866s1c1
Sequence:CCGGGCTACGAAAGTTATCTGACATCTCGAGATGTCAGATAACTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-720s1c1
Sequence:CCGGCCTGGCAGTCTCTGATAACATCTCGAGATGTTATCAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007897.1-1113s1c1
Sequence:CCGGCCAGAGGTTACAGAAGGTCATCTCGAGATGACCTTCTGTAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007897.1-1470s1c1
Sequence:CCGGCCCACAGCAAACCAACTATAACTCGAGTTATAGTTGGTTTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-486s1c1
Sequence:CCGGCCCTGAAATGTGCCGAGTATTCTCGAGAATACTCGGCACATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-875s21c1
Sequence:CCGGGCGCGACTGTGATCATCATAGCTCGAGCTATGATGATCACAGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007897.2-910s21c1
Sequence:CCGGGATGGGTTACAGGTCATATTCCTCGAGGAATATGACCTGTAACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-1859s21c1
Sequence:CCGGGGATTCTGCTACGAAAGTTATCTCGAGATAACTTTCGTAGCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007897.2-1115s21c1
Sequence:CCGGAGAGGTTACAGAAGGTCATTCCTCGAGGAATGACCTTCTGTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-219s21c1
Sequence:CCGGGCCTTCTAACCTGCGGAAATCCTCGAGGATTTCCGCAGGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-793s21c1
Sequence:CCGGTCGGAAGGTACGCCCTCTTATCTCGAGATAAGAGGGCGTACCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-1921s21c1
Sequence:CCGGTTAAGAGGAATCACACAATAACTCGAGTTATTGTGTGATTCCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007897
VALIDATED
EBF1 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-1866s1c1
Sequence:CCGGGCTACGAAAGTTATCTGACATCTCGAGATGTCAGATAACTTTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-720s1c1
Sequence:CCGGCCTGGCAGTCTCTGATAACATCTCGAGATGTTATCAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007897.1-1113s1c1
Sequence:CCGGCCAGAGGTTACAGAAGGTCATCTCGAGATGACCTTCTGTAACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007897.1-1470s1c1
Sequence:CCGGCCCACAGCAAACCAACTATAACTCGAGTTATAGTTGGTTTGCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007897.1-486s1c1
Sequence:CCGGCCCTGAAATGTGCCGAGTATTCTCGAGAATACTCGGCACATTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-875s21c1
Sequence:CCGGGCGCGACTGTGATCATCATAGCTCGAGCTATGATGATCACAGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007897.2-910s21c1
Sequence:CCGGGATGGGTTACAGGTCATATTCCTCGAGGAATATGACCTGTAACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-1859s21c1
Sequence:CCGGGGATTCTGCTACGAAAGTTATCTCGAGATAACTTTCGTAGCAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007897.2-1115s21c1
Sequence:CCGGAGAGGTTACAGAAGGTCATTCCTCGAGGAATGACCTTCTGTAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-219s21c1
Sequence:CCGGGCCTTCTAACCTGCGGAAATCCTCGAGGATTTCCGCAGGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-793s21c1
Sequence:CCGGTCGGAAGGTACGCCCTCTTATCTCGAGATAAGAGGGCGTACCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007897.2-1921s21c1
Sequence:CCGGTTAAGAGGAATCACACAATAACTCGAGTTATTGTGTGATTCCTCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks