EMAIL THIS PAGE TO A FRIEND

EBF2

early B-cell factor 2

163 Gene Product Result for
Synonyms: COE2 EBF-2 O/E-3 OE-3
UniProtKB ID: Q9HAK2, A0PJM4, A6NMF7, Q6DK36, Q6IS86, Q6ISA4
Gene ID:
Human(64641) Summary: The protein encoded by this gene belongs to the COE (Collier/Olf/EBF) family of non-basic, helix-loop-helix transcription factors that have a well conserved DNA binding domain. The COE family proteins play an important role in variety of developmental processes. Studies in mouse suggest that this gene may be involved in the differentiation of osteoblasts. [provided by RefSeq, Oct 2011]
Mouse(13592) early B cell factor 2
Rat(361060) early B-cell factor 2
Thale Cress(832607) EIN3-binding F-box protein 2
dog(477375) early B-cell factor 2
chicken(395176) early B-cell factor 2
cow(519342) early B-cell factor 2
Horse(100054268) early B-cell factor 2
domestic guinea pig(100732526) early B-cell factor 2
sheep(101110734) early B-cell factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36019 Anti-EBF2 antibody produced in rabbit IgG fraction of antiserum bovine, horse, human, rabbit, mouse, guinea pig, rat
western blot pricing
E8533 Anti-EBF2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2104260 Anti-EBF2 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, zebrafish, mouse, rat, rabbit, human, horse
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0077 AQUA Peptide AADIAEALYSVP[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022659 Rosetta Predictions human pricing
XM_927203 Rosetta Predictions human pricing
XM_931923 Rosetta Predictions human pricing
NM_001108383 Rosetta Predictions rat pricing
NM_010095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355920 predicted 882
2 SASI_Hs02_00355921 predicted 440
3 SASI_Hs02_00355922 predicted 1164
4 SASI_Hs02_00355923 predicted 1201
5 SASI_Hs02_00355924 predicted 862
6 SASI_Hs02_00355925 predicted 1799
7 SASI_Hs02_00355926 predicted 634
8 SASI_Hs02_00355927 predicted 434
9 SASI_Hs02_00355928 predicted 1158
10 SASI_Hs02_00355929 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272224 predicted 1434
2 SASI_Hs01_00272225 predicted 1448
3 SASI_Hs01_00272226 predicted 1431
4 SASI_Hs01_00272227 predicted 1470
5 SASI_Hs01_00272228 predicted 1498
6 SASI_Hs01_00272229 predicted 1495
7 SASI_Hs01_00272230 predicted 1467
8 SASI_Hs01_00272231 predicted 1470
9 SASI_Hs01_00272232 predicted 1503
10 SASI_Hs01_00272233 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296985 predicted 760
2 SASI_Hs01_00296986 predicted 950
3 SASI_Hs01_00296987 predicted 734
4 SASI_Hs01_00296988 predicted 1255
5 SASI_Hs01_00296989 predicted 623
6 SASI_Hs01_00296990 predicted 1212
7 SASI_Hs01_00296991 predicted 1107
8 SASI_Hs01_00296992 predicted 1109
9 SASI_Hs01_00296993 predicted 960
10 SASI_Hs01_00296994 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238119 predicted 2121
2 SASI_Rn02_00238120 predicted 1369
3 SASI_Rn02_00238121 predicted 1710
4 SASI_Rn02_00238122 predicted 1921
5 SASI_Rn02_00238123 predicted 2391
6 SASI_Rn02_00238124 predicted 2300
7 SASI_Rn02_00238125 predicted 1413
8 SASI_Rn02_00238126 predicted 2241
9 SASI_Rn02_00238127 predicted 1910
10 SASI_Rn02_00238128 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124259 predicted 1990
2 SASI_Mm01_00124260 predicted 1393
3 SASI_Mm01_00124261 predicted 2230
4 SASI_Mm01_00124262 predicted 2115
5 SASI_Mm01_00124263 predicted 1651
6 SASI_Mm02_00317791 predicted 1143
7 SASI_Mm01_00124264 predicted 1916
8 SASI_Mm01_00124265 predicted 2304
9 SASI_Mm01_00124266 predicted 1416
10 SASI_Mm01_00124267 predicted 1364
11 SASI_Mm01_00124268 predicted 1919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010095
EBF2 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010095.2-2944s1c1
Sequence:CCGGGCAGCAATTCTTTGTTATGAACTCGAGTTCATAACAAAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-2410s1c1
Sequence:CCGGCGGCTACAGCAATGTTCCTATCTCGAGATAGGAACATTGCTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1966s1c1
Sequence:CCGGGTTCATCTACACAGCCTTAAACTCGAGTTTAAGGCTGTGTAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1395s1c1
Sequence:CCGGGACAGAATAAGAATCCCGAAACTCGAGTTTCGGGATTCTTATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1979s1c1
Sequence:CCGGGCCTTAAATGAACCCACCATACTCGAGTATGGTGGGTTCATTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010095
EBF2 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010095.2-2944s1c1
Sequence:CCGGGCAGCAATTCTTTGTTATGAACTCGAGTTCATAACAAAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-2410s1c1
Sequence:CCGGCGGCTACAGCAATGTTCCTATCTCGAGATAGGAACATTGCTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1966s1c1
Sequence:CCGGGTTCATCTACACAGCCTTAAACTCGAGTTTAAGGCTGTGTAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1395s1c1
Sequence:CCGGGACAGAATAAGAATCCCGAAACTCGAGTTTCGGGATTCTTATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1979s1c1
Sequence:CCGGGCCTTAAATGAACCCACCATACTCGAGTATGGTGGGTTCATTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010095
EBF2 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010095.2-2944s1c1
Sequence:CCGGGCAGCAATTCTTTGTTATGAACTCGAGTTCATAACAAAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-2410s1c1
Sequence:CCGGCGGCTACAGCAATGTTCCTATCTCGAGATAGGAACATTGCTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1966s1c1
Sequence:CCGGGTTCATCTACACAGCCTTAAACTCGAGTTTAAGGCTGTGTAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1395s1c1
Sequence:CCGGGACAGAATAAGAATCCCGAAACTCGAGTTTCGGGATTCTTATTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010095.2-1979s1c1
Sequence:CCGGGCCTTAAATGAACCCACCATACTCGAGTATGGTGGGTTCATTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022659
EBF2 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-313s1c1
Sequence:CCGGGCATTAAATGAACCCACCATACTCGAGTATGGTGGGTTCATTTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-171s1c1
Sequence:CCGGGCTTGTATGGAGCGAGCTAATCTCGAGATTAGCTCGCTCCATACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-816s1c1
Sequence:CCGGCGGCTCTCCTTATGGAATCATCTCGAGATGATTCCATAAGGAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-698s1c1
Sequence:CCGGCCACGCCTCAACAGTCTAATTCTCGAGAATTAGACTGTTGAGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-239s1c1
Sequence:CCGGGCGTGGTAGAGGTGACATTATCTCGAGATAATGTCACCTCTACCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022659
EBF2 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-313s1c1
Sequence:CCGGGCATTAAATGAACCCACCATACTCGAGTATGGTGGGTTCATTTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-171s1c1
Sequence:CCGGGCTTGTATGGAGCGAGCTAATCTCGAGATTAGCTCGCTCCATACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-816s1c1
Sequence:CCGGCGGCTCTCCTTATGGAATCATCTCGAGATGATTCCATAAGGAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-698s1c1
Sequence:CCGGCCACGCCTCAACAGTCTAATTCTCGAGAATTAGACTGTTGAGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-239s1c1
Sequence:CCGGGCGTGGTAGAGGTGACATTATCTCGAGATAATGTCACCTCTACCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022659
EBF2 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-313s1c1
Sequence:CCGGGCATTAAATGAACCCACCATACTCGAGTATGGTGGGTTCATTTAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-171s1c1
Sequence:CCGGGCTTGTATGGAGCGAGCTAATCTCGAGATTAGCTCGCTCCATACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-816s1c1
Sequence:CCGGCGGCTCTCCTTATGGAATCATCTCGAGATGATTCCATAAGGAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-698s1c1
Sequence:CCGGCCACGCCTCAACAGTCTAATTCTCGAGAATTAGACTGTTGAGGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022659.1-239s1c1
Sequence:CCGGGCGTGGTAGAGGTGACATTATCTCGAGATAATGTCACCTCTACCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks