EMAIL THIS PAGE TO A FRIEND

EBF3

early B-cell factor 3

Synonyms: COE3 EBF-3 O/E-2 OE-2
UniProtKB ID: Q9H4W6, A0AUY1, Q5T6H9, Q9H4W5
Gene ID:
Human(253738) Summary: This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
Mouse(13593) early B cell factor 3
Rat(361668) early B-cell factor 3
sheep(101107152) early B-cell factor 3
domestic guinea pig(100732902) early B-cell factor 3
naked mole-rat(101713032) early B-cell factor 3
Zebrafish(567751) early B-cell factor 3
cow(525353) early B-cell factor 3
domestic cat(101085322) early B-cell factor 3
dog(611743) early B-cell factor 3
chicken(395175) early B-cell factor 3
229 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0077 AQUA Peptide AADIAEALYSVP[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005463 Rosetta Predictions human pricing
NM_001108506 Rosetta Predictions rat pricing
NM_001113414 Rosetta Predictions mouse pricing
NM_001113415 Rosetta Predictions mouse pricing
NM_010096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064740 predicted 1066
2 SASI_Hs01_00064741 predicted 296
3 SASI_Hs01_00064742 predicted 1070
4 SASI_Hs01_00064743 predicted 380
5 SASI_Hs01_00064744 predicted 702
6 SASI_Hs01_00064745 predicted 1763
7 SASI_Hs01_00064746 predicted 915
8 SASI_Hs01_00064749 predicted 1679
9 SASI_Hs02_00304923 predicted 683
10 SASI_Hs02_00304924 predicted 1570
11 SASI_Hs01_00064747 predicted 1799
12 SASI_Hs01_00064748 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239319 predicted 1442
2 SASI_Rn02_00239320 predicted 1283
3 SASI_Rn02_00239321 predicted 941
4 SASI_Rn02_00239322 predicted 714
5 SASI_Rn02_00239323 predicted 1769
6 SASI_Rn02_00239324 predicted 1297
7 SASI_Rn02_00239325 predicted 2160
8 SASI_Rn02_00239326 predicted 954
9 SASI_Rn02_00239327 predicted 1950
10 SASI_Rn02_00239328 predicted 2273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307806 predicted 1541
2 SASI_Mm02_00307807 predicted 1540
3 SASI_Mm02_00307808 predicted 2581
4 SASI_Mm02_00307809 predicted 2486
5 SASI_Mm02_00307810 predicted 1663
6 SASI_Mm02_00307811 predicted 2554
7 SASI_Mm02_00307812 predicted 841
8 SASI_Mm02_00307813 predicted 1025
9 SASI_Mm02_00307814 predicted 2403
10 SASI_Mm02_00307815 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307816 predicted 1569
2 SASI_Mm02_00307817 predicted 1572
3 SASI_Mm02_00307818 predicted 2607
4 SASI_Mm02_00307819 predicted 2515
5 SASI_Mm02_00307820 predicted 1693
6 SASI_Mm02_00307821 predicted 2581
7 SASI_Mm02_00307822 predicted 837
8 SASI_Mm02_00307823 predicted 1027
9 SASI_Mm02_00307824 predicted 2433
10 SASI_Mm02_00307825 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080655 predicted 1543
2 SASI_Mm02_00317792 predicted 1543
3 SASI_Mm02_00317793 predicted 2473
4 SASI_Mm02_00317794 predicted 2381
5 SASI_Mm02_00317795 predicted 2441
6 SASI_Mm01_00080660 predicted 840
7 SASI_Mm01_00080663 predicted 1028
8 SASI_Mm02_00317796 predicted 2293
9 SASI_Mm02_00317797 predicted 917
10 SASI_Mm02_00317798 predicted 931
11 SASI_Mm01_00080656 predicted 2252
12 SASI_Mm01_00080657 predicted 1073
13 SASI_Mm01_00080658 predicted 1378
14 SASI_Mm01_00080659 predicted 2044
15 SASI_Mm01_00080661 predicted 2262
16 SASI_Mm01_00080662 predicted 1868
17 SASI_Mm01_00080664 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005463
EBF3 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005463.1-1087s1c1
Sequence:CCGGCCATAGATTACGGCTTTCAGACTCGAGTCTGAAAGCCGTAATCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005463.1-1495s1c1
Sequence:CCGGCTAGCATGAATGGATATGGAACTCGAGTTCCATATCCATTCATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-3162s1c1
Sequence:CCGGCGTGACAAATCCTAGTAGATTCTCGAGAATCTACTAGGATTTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005463.1-908s1c1
Sequence:CCGGGCAAGTTGTATTCGGAACTATCTCGAGATAGTTCCGAATACAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-2773s1c1
Sequence:CCGGGCAGTTGCTAAGGGACTTTATCTCGAGATAAAGTCCCTTAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-3161s1c1
Sequence:CCGGCCGTGACAAATCCTAGTAGATCTCGAGATCTACTAGGATTTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005463.1-684s1c1
Sequence:CCGGCGGAGATTCCAGGTTGTTGTACTCGAGTACAACAACCTGGAATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-864s21c1
Sequence:CCGGGGTGCCACCGTCATCATAATTCTCGAGAATTATGATGACGGTGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005463.1-2019s21c1
Sequence:CCGGGTCTTGGCCATGTCTAGTAATCTCGAGATTACTAGACATGGCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-1403s21c1
Sequence:CCGGAGTCGGCTACAGTCGCAATACCTCGAGGTATTGCGACTGTAGCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-441s21c1
Sequence:CCGGGTTCGCCTCATAGATTCAATGCTCGAGCATTGAATCTATGAGGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005463
EBF3 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005463.1-1087s1c1
Sequence:CCGGCCATAGATTACGGCTTTCAGACTCGAGTCTGAAAGCCGTAATCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005463.1-1495s1c1
Sequence:CCGGCTAGCATGAATGGATATGGAACTCGAGTTCCATATCCATTCATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-3162s1c1
Sequence:CCGGCGTGACAAATCCTAGTAGATTCTCGAGAATCTACTAGGATTTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005463.1-908s1c1
Sequence:CCGGGCAAGTTGTATTCGGAACTATCTCGAGATAGTTCCGAATACAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-2773s1c1
Sequence:CCGGGCAGTTGCTAAGGGACTTTATCTCGAGATAAAGTCCCTTAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-3161s1c1
Sequence:CCGGCCGTGACAAATCCTAGTAGATCTCGAGATCTACTAGGATTTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005463.1-684s1c1
Sequence:CCGGCGGAGATTCCAGGTTGTTGTACTCGAGTACAACAACCTGGAATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-864s21c1
Sequence:CCGGGGTGCCACCGTCATCATAATTCTCGAGAATTATGATGACGGTGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005463.1-2019s21c1
Sequence:CCGGGTCTTGGCCATGTCTAGTAATCTCGAGATTACTAGACATGGCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-1403s21c1
Sequence:CCGGAGTCGGCTACAGTCGCAATACCTCGAGGTATTGCGACTGTAGCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-441s21c1
Sequence:CCGGGTTCGCCTCATAGATTCAATGCTCGAGCATTGAATCTATGAGGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005463
EBF3 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005463.1-1087s1c1
Sequence:CCGGCCATAGATTACGGCTTTCAGACTCGAGTCTGAAAGCCGTAATCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005463.1-1495s1c1
Sequence:CCGGCTAGCATGAATGGATATGGAACTCGAGTTCCATATCCATTCATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-3162s1c1
Sequence:CCGGCGTGACAAATCCTAGTAGATTCTCGAGAATCTACTAGGATTTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005463.1-908s1c1
Sequence:CCGGGCAAGTTGTATTCGGAACTATCTCGAGATAGTTCCGAATACAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-2773s1c1
Sequence:CCGGGCAGTTGCTAAGGGACTTTATCTCGAGATAAAGTCCCTTAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005463.1-3161s1c1
Sequence:CCGGCCGTGACAAATCCTAGTAGATCTCGAGATCTACTAGGATTTGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005463.1-684s1c1
Sequence:CCGGCGGAGATTCCAGGTTGTTGTACTCGAGTACAACAACCTGGAATCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-864s21c1
Sequence:CCGGGGTGCCACCGTCATCATAATTCTCGAGAATTATGATGACGGTGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005463.1-2019s21c1
Sequence:CCGGGTCTTGGCCATGTCTAGTAATCTCGAGATTACTAGACATGGCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-1403s21c1
Sequence:CCGGAGTCGGCTACAGTCGCAATACCTCGAGGTATTGCGACTGTAGCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005463.1-441s21c1
Sequence:CCGGGTTCGCCTCATAGATTCAATGCTCGAGCATTGAATCTATGAGGCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010096
EBF3 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010096.1-2248s1c1
Sequence:CCGGCGAGGATATGACTAGGTGAATCTCGAGATTCACCTAGTCATATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-461s1c1
Sequence:CCGGCTCATAGATTCAATGACCAAACTCGAGTTTGGTCATTGAATCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-712s1c1
Sequence:CCGGCGTTGTATCGACAACAGTCAACTCGAGTTGACTGTTGTCGATACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-460s1c1
Sequence:CCGGCCTCATAGATTCAATGACCAACTCGAGTTGGTCATTGAATCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-1085s1c1
Sequence:CCGGGCCCTTAATGAGCCAACCATACTCGAGTATGGTTGGCTCATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010096.3-2621s21c1
Sequence:CCGGATGGTTGTGTATCTCTATAATCTCGAGATTATAGAGATACACAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-1826s21c1
Sequence:CCGGAGCAGCCAGCTAGCCGTTAATCTCGAGATTAACGGCTAGCTGGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010096.3-2449s21c1
Sequence:CCGGGAAACAAAGCACCGCCTATTTCTCGAGAAATAGGCGGTGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-1876s21c1
Sequence:CCGGAGTCGGCTACAGTCGCAATACCTCGAGGTATTGCGACTGTAGCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-712s21c1
Sequence:CCGGCAACCTCCGGAAATCCAATTTCTCGAGAAATTGGATTTCCGGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010096
EBF3 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010096.1-2248s1c1
Sequence:CCGGCGAGGATATGACTAGGTGAATCTCGAGATTCACCTAGTCATATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-461s1c1
Sequence:CCGGCTCATAGATTCAATGACCAAACTCGAGTTTGGTCATTGAATCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-712s1c1
Sequence:CCGGCGTTGTATCGACAACAGTCAACTCGAGTTGACTGTTGTCGATACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-460s1c1
Sequence:CCGGCCTCATAGATTCAATGACCAACTCGAGTTGGTCATTGAATCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-1085s1c1
Sequence:CCGGGCCCTTAATGAGCCAACCATACTCGAGTATGGTTGGCTCATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010096.3-2621s21c1
Sequence:CCGGATGGTTGTGTATCTCTATAATCTCGAGATTATAGAGATACACAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-1826s21c1
Sequence:CCGGAGCAGCCAGCTAGCCGTTAATCTCGAGATTAACGGCTAGCTGGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010096.3-2449s21c1
Sequence:CCGGGAAACAAAGCACCGCCTATTTCTCGAGAAATAGGCGGTGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-1876s21c1
Sequence:CCGGAGTCGGCTACAGTCGCAATACCTCGAGGTATTGCGACTGTAGCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-712s21c1
Sequence:CCGGCAACCTCCGGAAATCCAATTTCTCGAGAAATTGGATTTCCGGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010096
EBF3 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010096.1-2248s1c1
Sequence:CCGGCGAGGATATGACTAGGTGAATCTCGAGATTCACCTAGTCATATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-461s1c1
Sequence:CCGGCTCATAGATTCAATGACCAAACTCGAGTTTGGTCATTGAATCTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-712s1c1
Sequence:CCGGCGTTGTATCGACAACAGTCAACTCGAGTTGACTGTTGTCGATACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-460s1c1
Sequence:CCGGCCTCATAGATTCAATGACCAACTCGAGTTGGTCATTGAATCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010096.1-1085s1c1
Sequence:CCGGGCCCTTAATGAGCCAACCATACTCGAGTATGGTTGGCTCATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010096.3-2621s21c1
Sequence:CCGGATGGTTGTGTATCTCTATAATCTCGAGATTATAGAGATACACAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-1826s21c1
Sequence:CCGGAGCAGCCAGCTAGCCGTTAATCTCGAGATTAACGGCTAGCTGGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010096.3-2449s21c1
Sequence:CCGGGAAACAAAGCACCGCCTATTTCTCGAGAAATAGGCGGTGCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-1876s21c1
Sequence:CCGGAGTCGGCTACAGTCGCAATACCTCGAGGTATTGCGACTGTAGCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010096.3-712s21c1
Sequence:CCGGCAACCTCCGGAAATCCAATTTCTCGAGAAATTGGATTTCCGGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks