EMAIL THIS PAGE TO A FRIEND

EBF4

early B-cell factor 4

188 Gene Product Result for
Synonyms: COE4 O/E-4
UniProtKB ID: Q9BQW3, Q1MTP7, Q5JY53, Q9NUB6, Q9P2A6
Gene ID:
Human(57593) Summary: EBF4 belongs to the conserved Olf/EBF family of helix-loop-helix transcription factors, members of which play important roles in neural development and B-cell maturation (Wang et al., 2002 [PubMed 12139918]
Mouse(228598) early B cell factor 4
Rat(680751) early B-cell factor 4
dog(485803) early B-cell factor 4
cow(506470) early B-cell factor 4
domestic cat(101082740) early B-cell factor 4
naked mole-rat(101710281) early B-cell factor 4
domestic guinea pig(100716850) early B-cell factor 4
sheep(101113517) early B-cell factor 4
Domestic Rabbit(100353007) early B-cell factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51733 Anti-EBF4 antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
AV37502 Anti-EBF4 antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, canine, mouse, human, horse, rabbit, bovine
western blot pricing
SAB2103156 Anti-EBF4 antibody produced in rabbit affinity isolated antibody bovine, rat, horse, rabbit, mouse, zebrafish, human, guinea pig, canine,
western blot pricing
SAB2105371 Anti-EBF4 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001110513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001110514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001110514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001110514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110514 Rosetta Predictions human pricing
XM_001713721 Rosetta Predictions human pricing
XM_001713722 Rosetta Predictions human pricing
XM_001717843 Rosetta Predictions human pricing
XM_044921 Rosetta Predictions human pricing
XM_001059875 Rosetta Predictions rat pricing
NM_001110513 Rosetta Predictions mouse pricing
NM_152993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324995 predicted 2472
2 SASI_Hs02_00324996 predicted 707
3 SASI_Hs02_00324997 predicted 434
4 SASI_Hs02_00324998 predicted 2506
5 SASI_Hs02_00324999 predicted 1072
6 SASI_Hs02_00325000 predicted 2382
7 SASI_Hs02_00325001 predicted 561
8 SASI_Hs02_00325002 predicted 2347
9 SASI_Hs02_00325003 predicted 1066
10 SASI_Hs02_00325004 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392809 predicted 2338
2 SASI_Hs02_00392810 predicted 2357
3 SASI_Hs02_00392811 predicted 2272
4 SASI_Hs02_00392812 predicted 2228
5 SASI_Hs02_00392813 predicted 2049
6 SASI_Hs02_00392814 predicted 2172
7 SASI_Hs02_00392815 predicted 2350
8 SASI_Hs02_00392816 predicted 2213
9 SASI_Hs02_00392817 predicted 2167
10 SASI_Hs02_00392818 predicted 2354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392819 predicted 2357
2 SASI_Hs02_00392820 predicted 2354
3 SASI_Hs02_00392821 predicted 707
4 SASI_Hs02_00392822 predicted 440
5 SASI_Hs02_00392823 predicted 1073
6 SASI_Hs02_00392824 predicted 517
7 SASI_Hs02_00392825 predicted 2265
8 SASI_Hs02_00392826 predicted 565
9 SASI_Hs02_00392827 predicted 2231
10 SASI_Hs02_00392828 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419888 predicted 540
2 SASI_Hs02_00419889 predicted 344
3 SASI_Hs02_00419890 predicted 1632
4 SASI_Hs02_00419891 predicted 1652
5 SASI_Hs02_00419892 predicted 611
6 SASI_Hs02_00419893 predicted 2152
7 SASI_Hs02_00419894 predicted 656
8 SASI_Hs02_00419895 predicted 2109
9 SASI_Hs02_00419896 predicted 1172
10 SASI_Hs02_00419897 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_044921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258439 predicted 2583
2 SASI_Hs01_00258440 predicted 2562
3 SASI_Hs01_00258441 predicted 2488
4 SASI_Hs01_00258442 predicted 2453
5 SASI_Hs01_00258443 predicted 2271
6 SASI_Hs01_00258444 predicted 2403
7 SASI_Hs01_00258445 predicted 2575
8 SASI_Hs01_00258446 predicted 2433
9 SASI_Hs01_00258447 predicted 664
10 SASI_Hs01_00258448 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294684 predicted 1141
2 SASI_Rn02_00294685 predicted 533
3 SASI_Rn02_00294686 predicted 332
4 SASI_Rn02_00294687 predicted 369
5 SASI_Rn02_00294688 predicted 1095
6 SASI_Rn02_00294689 predicted 376
7 SASI_Rn02_00294690 predicted 1124
8 SASI_Rn02_00294691 predicted 422
9 SASI_Rn02_00294692 predicted 1033
10 SASI_Rn02_00294693 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305628 predicted 387
2 SASI_Mm02_00305629 predicted 455
3 SASI_Mm02_00305630 predicted 976
4 SASI_Mm02_00305631 predicted 610
5 SASI_Mm02_00305632 predicted 1229
6 SASI_Mm02_00305633 predicted 609
7 SASI_Mm02_00305634 predicted 1912
8 SASI_Mm02_00305635 predicted 1086
9 SASI_Mm02_00305636 predicted 598
10 SASI_Mm02_00305637 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164391 predicted 387
2 SASI_Mm01_00164392 predicted 461
3 SASI_Mm01_00164393 predicted 973
4 SASI_Mm01_00164394 predicted 613
5 SASI_Mm01_00164395 predicted 1238
6 SASI_Mm01_00164396 predicted 615
7 SASI_Mm01_00164397 predicted 1799
8 SASI_Mm01_00164398 predicted 1096
9 SASI_Mm01_00164399 predicted 609
10 SASI_Mm01_00164400 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110513
EBF4 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000427292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-481s21c1
Sequence:CCGGCGAAGCAGGCTATCATCTATGCTCGAGCATAGATGATAGCCTGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110513.1-2275s21c1
Sequence:CCGGCAATCATACCTGACCTAATAGCTCGAGCTATTAGGTCAGGTATGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-1855s21c1
Sequence:CCGGAGGGCTTGGCATACTCCTAATCTCGAGATTAGGAGTATGCCAAGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-450s21c1
Sequence:CCGGGACCTCTACGTGCGCCTTATTCTCGAGAATAAGGCGCACGTAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110513
EBF4 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000427292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-481s21c1
Sequence:CCGGCGAAGCAGGCTATCATCTATGCTCGAGCATAGATGATAGCCTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110513.1-2275s21c1
Sequence:CCGGCAATCATACCTGACCTAATAGCTCGAGCTATTAGGTCAGGTATGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-1855s21c1
Sequence:CCGGAGGGCTTGGCATACTCCTAATCTCGAGATTAGGAGTATGCCAAGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-450s21c1
Sequence:CCGGGACCTCTACGTGCGCCTTATTCTCGAGAATAAGGCGCACGTAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110513
EBF4 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000427292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-481s21c1
Sequence:CCGGCGAAGCAGGCTATCATCTATGCTCGAGCATAGATGATAGCCTGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110513.1-2275s21c1
Sequence:CCGGCAATCATACCTGACCTAATAGCTCGAGCTATTAGGTCAGGTATGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-1855s21c1
Sequence:CCGGAGGGCTTGGCATACTCCTAATCTCGAGATTAGGAGTATGCCAAGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110513.1-450s21c1
Sequence:CCGGGACCTCTACGTGCGCCTTATTCTCGAGAATAAGGCGCACGTAGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110514
EBF4 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-568s21c1
Sequence:CCGGGACTAACAATGGGATCCATTACTCGAGTAATGGATCCCATTGTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-594s21c1
Sequence:CCGGTCCGGCTGGTGTATAACAATGCTCGAGCATTGTTATACACCAGCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-2046s21c1
Sequence:CCGGAGGGCCTGGCATACTCCTAATCTCGAGATTAGGAGTATGCCAGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110514.1-2356s21c1
Sequence:CCGGGGGTCTTGGTTCCTCTGAAAGCTCGAGCTTTCAGAGGAACCAAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-1890s21c1
Sequence:CCGGACATGATCTCCGCCGTCAAACCTCGAGGTTTGACGGCGGAGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110514
EBF4 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-568s21c1
Sequence:CCGGGACTAACAATGGGATCCATTACTCGAGTAATGGATCCCATTGTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-594s21c1
Sequence:CCGGTCCGGCTGGTGTATAACAATGCTCGAGCATTGTTATACACCAGCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-2046s21c1
Sequence:CCGGAGGGCCTGGCATACTCCTAATCTCGAGATTAGGAGTATGCCAGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110514.1-2356s21c1
Sequence:CCGGGGGTCTTGGTTCCTCTGAAAGCTCGAGCTTTCAGAGGAACCAAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-1890s21c1
Sequence:CCGGACATGATCTCCGCCGTCAAACCTCGAGGTTTGACGGCGGAGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110514
EBF4 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-568s21c1
Sequence:CCGGGACTAACAATGGGATCCATTACTCGAGTAATGGATCCCATTGTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-594s21c1
Sequence:CCGGTCCGGCTGGTGTATAACAATGCTCGAGCATTGTTATACACCAGCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-2046s21c1
Sequence:CCGGAGGGCCTGGCATACTCCTAATCTCGAGATTAGGAGTATGCCAGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001110514.1-2356s21c1
Sequence:CCGGGGGTCTTGGTTCCTCTGAAAGCTCGAGCTTTCAGAGGAACCAAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110514.1-1890s21c1
Sequence:CCGGACATGATCTCCGCCGTCAAACCTCGAGGTTTGACGGCGGAGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152993
EBF4 MISSION shRNA Bacterial Glycerol Stock
early B-cell factor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152993.1-1916s1c1
Sequence:CCGGCCCTCATACTTACCTCTCTTTCTCGAGAAAGAGAGGTAAGTATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-893s1c1
Sequence:CCGGCGTCATTATCATCGGAGACAACTCGAGTTGTCTCCGATGATAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-604s1c1
Sequence:CCGGCGCCTTCTGATCCAGTCATTACTCGAGTAATGACTGGATCAGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-606s1c1
Sequence:CCGGCCTTCTGATCCAGTCATTATTCTCGAGAATAATGACTGGATCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-417s1c1
Sequence:CCGGCTGGTGTATAATAATGGACTTCTCGAGAAGTCCATTATTATACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152993
EBF4 MISSION shRNA shRNA Plasmid DNA
early B-cell factor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152993.1-1916s1c1
Sequence:CCGGCCCTCATACTTACCTCTCTTTCTCGAGAAAGAGAGGTAAGTATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-893s1c1
Sequence:CCGGCGTCATTATCATCGGAGACAACTCGAGTTGTCTCCGATGATAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-604s1c1
Sequence:CCGGCGCCTTCTGATCCAGTCATTACTCGAGTAATGACTGGATCAGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-606s1c1
Sequence:CCGGCCTTCTGATCCAGTCATTATTCTCGAGAATAATGACTGGATCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-417s1c1
Sequence:CCGGCTGGTGTATAATAATGGACTTCTCGAGAAGTCCATTATTATACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152993
EBF4 MISSION shRNA Lentiviral Transduction Particles
early B-cell factor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152993.1-1916s1c1
Sequence:CCGGCCCTCATACTTACCTCTCTTTCTCGAGAAAGAGAGGTAAGTATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-893s1c1
Sequence:CCGGCGTCATTATCATCGGAGACAACTCGAGTTGTCTCCGATGATAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-604s1c1
Sequence:CCGGCGCCTTCTGATCCAGTCATTACTCGAGTAATGACTGGATCAGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-606s1c1
Sequence:CCGGCCTTCTGATCCAGTCATTATTCTCGAGAATAATGACTGGATCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152993.1-417s1c1
Sequence:CCGGCTGGTGTATAATAATGGACTTCTCGAGAAGTCCATTATTATACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)