EMAIL THIS PAGE TO A FRIEND

EBI3

Epstein-Barr virus induced 3

74 Gene Product Result for
Synonyms: IL-27B IL27B
UniProtKB ID: Q14213, A0N0N2, O75269
Gene ID:
Human(10148) Summary: This gene was identified by its induced expression in B lymphocytes in response Epstein-Barr virus infection. It encodes a secreted glycoprotein belonging to the hematopoietin receptor family, and heterodimerizes with a 28 kDa protein to form interleukin 27 (IL-27). IL-27 regulates T cell and inflammatory responses, in part by activating the Jak/STAT pathway of CD4+ T cells. [provided by RefSeq, Sep 2008]
Mouse(50498) Epstein-Barr virus induced gene 3
Rat(680609) Epstein-Barr virus induced 3
Zebrafish(100134974) Epstein-Barr virus induced gene 3
cow(514933) Epstein-Barr virus induced 3
domestic cat(101101032) Epstein-Barr virus induced 3
dog(485043) Epstein-Barr virus induced 3
sheep(101113064) Epstein-Barr virus induced 3
domestic guinea pig(100734105) Epstein-Barr virus induced 3
naked mole-rat(101705007) Epstein-Barr virus induced 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005755 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005755 Rosetta Predictions human pricing
NM_001109421 Rosetta Predictions rat pricing
NM_015766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193338 predicted 474
2 SASI_Hs01_00193339 predicted 299
3 SASI_Hs01_00193340 predicted 353
4 SASI_Hs01_00193341 predicted 480
5 SASI_Hs01_00193342 predicted 264
6 SASI_Hs01_00193343 predicted 470
7 SASI_Hs02_00340225 predicted 418
8 SASI_Hs01_00193344 predicted 357
9 SASI_Hs01_00193345 predicted 508
10 SASI_Hs01_00193346 predicted 262
11 SASI_Hs01_00193347 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248247 predicted 612
2 SASI_Rn02_00248248 predicted 551
3 SASI_Rn02_00248249 predicted 791
4 SASI_Rn02_00248250 predicted 841
5 SASI_Rn02_00248251 predicted 954
6 SASI_Rn02_00248252 predicted 722
7 SASI_Rn02_00248253 predicted 941
8 SASI_Rn02_00248254 predicted 555
9 SASI_Rn02_00248255 predicted 874
10 SASI_Rn02_00248256 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038352 predicted 769
2 SASI_Mm01_00038353 predicted 928
3 SASI_Mm01_00038354 predicted 776
4 SASI_Mm01_00038355 predicted 408
5 SASI_Mm01_00038356 predicted 926
6 SASI_Mm01_00038357 predicted 586
7 SASI_Mm01_00038359 predicted 531
8 SASI_Mm01_00038360 predicted 588
9 SASI_Mm01_00038361 predicted 584
10 SASI_Mm02_00323099 predicted 849
11 SASI_Mm01_00038358 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015766
EBI3 MISSION shRNA Bacterial Glycerol Stock
Epstein-Barr virus induced 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-846s1c1
Sequence:CCGGGCTCAGGACCTCACAGATTATCTCGAGATAATCTGTGAGGTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-413s1c1
Sequence:CCGGCACGTCCTTCATTGCCACTTACTCGAGTAAGTGGCAATGAAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-336s1c1
Sequence:CCGGCAATGCCATGCTTCTCGGTATCTCGAGATACCGAGAAGCATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015766.2-1028s1c1
Sequence:CCGGGCTCCGAAGCACTGGATAATTCTCGAGAATTATCCAGTGCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-776s1c1
Sequence:CCGGACCCATTGAAGCCACGACTTTCTCGAGAAAGTCGTGGCTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015766.2-928s21c1
Sequence:CCGGGAGGGACTGGATCCTTGATATCTCGAGATATCAAGGATCCAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015766.2-818s21c1
Sequence:CCGGCCATGCCAAGTATTGCATCCACTCGAGTGGATGCAATACTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015766.2-531s21c1
Sequence:CCGGACGGTGCCCTACATGCTAAATCTCGAGATTTAGCATGTAGGGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015766
EBI3 MISSION shRNA shRNA Plasmid DNA
Epstein-Barr virus induced 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-846s1c1
Sequence:CCGGGCTCAGGACCTCACAGATTATCTCGAGATAATCTGTGAGGTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-413s1c1
Sequence:CCGGCACGTCCTTCATTGCCACTTACTCGAGTAAGTGGCAATGAAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-336s1c1
Sequence:CCGGCAATGCCATGCTTCTCGGTATCTCGAGATACCGAGAAGCATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015766.2-1028s1c1
Sequence:CCGGGCTCCGAAGCACTGGATAATTCTCGAGAATTATCCAGTGCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-776s1c1
Sequence:CCGGACCCATTGAAGCCACGACTTTCTCGAGAAAGTCGTGGCTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015766.2-928s21c1
Sequence:CCGGGAGGGACTGGATCCTTGATATCTCGAGATATCAAGGATCCAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015766.2-818s21c1
Sequence:CCGGCCATGCCAAGTATTGCATCCACTCGAGTGGATGCAATACTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015766.2-531s21c1
Sequence:CCGGACGGTGCCCTACATGCTAAATCTCGAGATTTAGCATGTAGGGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015766
EBI3 MISSION shRNA Lentiviral Transduction Particles
Epstein-Barr virus induced 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-846s1c1
Sequence:CCGGGCTCAGGACCTCACAGATTATCTCGAGATAATCTGTGAGGTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-413s1c1
Sequence:CCGGCACGTCCTTCATTGCCACTTACTCGAGTAAGTGGCAATGAAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-336s1c1
Sequence:CCGGCAATGCCATGCTTCTCGGTATCTCGAGATACCGAGAAGCATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015766.2-1028s1c1
Sequence:CCGGGCTCCGAAGCACTGGATAATTCTCGAGAATTATCCAGTGCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015766.2-776s1c1
Sequence:CCGGACCCATTGAAGCCACGACTTTCTCGAGAAAGTCGTGGCTTCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015766.2-928s21c1
Sequence:CCGGGAGGGACTGGATCCTTGATATCTCGAGATATCAAGGATCCAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015766.2-818s21c1
Sequence:CCGGCCATGCCAAGTATTGCATCCACTCGAGTGGATGCAATACTTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015766.2-531s21c1
Sequence:CCGGACGGTGCCCTACATGCTAAATCTCGAGATTTAGCATGTAGGGCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005755
EBI3 MISSION shRNA Bacterial Glycerol Stock
Epstein-Barr virus induced 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-365s1c1
Sequence:CCGGGCCTTTCATAACAGAGCACATCTCGAGATGTGCTCTGTTATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-594s1c1
Sequence:CCGGCGAGCCAGGTACTACGTCCAACTCGAGTTGGACGTAGTACCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-185s1c1
Sequence:CCGGCGTGTCCTTCATTGCCACGTACTCGAGTACGTGGCAATGAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-479s1c1
Sequence:CCGGCCCAGAGATCTTCTCACTGAACTCGAGTTCAGTGAGAAGATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005755.2-303s21c1
Sequence:CCGGATGGCTCCCTACGTGCTCAATCTCGAGATTGAGCACGTAGGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005755.2-677s21c1
Sequence:CCGGCACAATGAGCCTGGGCAAGTACTCGAGTACTTGCCCAGGCTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005755.2-891s21c1
Sequence:CCGGATGTACTACTCTCTCCTTTACCTCGAGGTAAAGGAGAGAGTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005755.2-941s21c1
Sequence:CCGGTGAACTGTCACTGTGAGATATCTCGAGATATCTCACAGTGACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005755
EBI3 MISSION shRNA shRNA Plasmid DNA
Epstein-Barr virus induced 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-365s1c1
Sequence:CCGGGCCTTTCATAACAGAGCACATCTCGAGATGTGCTCTGTTATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-594s1c1
Sequence:CCGGCGAGCCAGGTACTACGTCCAACTCGAGTTGGACGTAGTACCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-185s1c1
Sequence:CCGGCGTGTCCTTCATTGCCACGTACTCGAGTACGTGGCAATGAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-479s1c1
Sequence:CCGGCCCAGAGATCTTCTCACTGAACTCGAGTTCAGTGAGAAGATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005755.2-303s21c1
Sequence:CCGGATGGCTCCCTACGTGCTCAATCTCGAGATTGAGCACGTAGGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005755.2-677s21c1
Sequence:CCGGCACAATGAGCCTGGGCAAGTACTCGAGTACTTGCCCAGGCTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005755.2-891s21c1
Sequence:CCGGATGTACTACTCTCTCCTTTACCTCGAGGTAAAGGAGAGAGTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005755.2-941s21c1
Sequence:CCGGTGAACTGTCACTGTGAGATATCTCGAGATATCTCACAGTGACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005755
EBI3 MISSION shRNA Lentiviral Transduction Particles
Epstein-Barr virus induced 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-365s1c1
Sequence:CCGGGCCTTTCATAACAGAGCACATCTCGAGATGTGCTCTGTTATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-594s1c1
Sequence:CCGGCGAGCCAGGTACTACGTCCAACTCGAGTTGGACGTAGTACCTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-185s1c1
Sequence:CCGGCGTGTCCTTCATTGCCACGTACTCGAGTACGTGGCAATGAAGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005755.2-479s1c1
Sequence:CCGGCCCAGAGATCTTCTCACTGAACTCGAGTTCAGTGAGAAGATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005755.2-303s21c1
Sequence:CCGGATGGCTCCCTACGTGCTCAATCTCGAGATTGAGCACGTAGGGAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005755.2-677s21c1
Sequence:CCGGCACAATGAGCCTGGGCAAGTACTCGAGTACTTGCCCAGGCTCATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005755.2-891s21c1
Sequence:CCGGATGTACTACTCTCTCCTTTACCTCGAGGTAAAGGAGAGAGTAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005755.2-941s21c1
Sequence:CCGGTGAACTGTCACTGTGAGATATCTCGAGATATCTCACAGTGACAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks