EMAIL THIS PAGE TO A FRIEND

EBLN2

endogenous Bornavirus-like nucleoprotein 2

19 Gene Product Result for
Synonyms: EBLN-2
Species: Human EBLN2(55096)
UniProtKB ID: Q6P2I7, Q8WWH3, Q9NW89
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018029 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018029 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351131 predicted 851
2 SASI_Hs01_00113074 predicted 990
3 SASI_Hs01_00113075 predicted 1062
4 SASI_Hs01_00113076 predicted 743
5 SASI_Hs01_00113077 predicted 666
6 SASI_Hs01_00113078 predicted 790
7 SASI_Hs01_00113079 predicted 905
8 SASI_Hs01_00113081 predicted 933
9 SASI_Hs01_00113082 predicted 918
10 SASI_Hs02_00351132 predicted 1000
11 SASI_Hs01_00113080 predicted 759
12 SASI_Hs01_00113083 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018029
EBLN2 MISSION shRNA Bacterial Glycerol Stock
endogenous Bornavirus-like nucleoprotein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018029.3-1446s21c1
Sequence:CCGGCACGAATGTTCCCAAACTTAGCTCGAGCTAAGTTTGGGAACATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-538s21c1
Sequence:CCGGGAATTAAGTCGGAACCAATTTCTCGAGAAATTGGTTCCGACTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-1061s21c1
Sequence:CCGGAGGCAATGATGGCATCTATTGCTCGAGCAATAGATGCCATCATTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-1161s21c1
Sequence:CCGGACCGTGGGTTGGAGAATTAATCTCGAGATTAATTCTCCAACCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018029.3-1246s1c1
Sequence:CCGGCCAAGAAAGCACAGATGACAACTCGAGTTGTCATCTGTGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-921s1c1
Sequence:CCGGCAGATTCAAAGATATGCCTAACTCGAGTTAGGCATATCTTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-920s1c1
Sequence:CCGGGCAGATTCAAAGATATGCCTACTCGAGTAGGCATATCTTTGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-1006s1c1
Sequence:CCGGGCTGGATCAAGTGATAAGATTCTCGAGAATCTTATCACTTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018029
EBLN2 MISSION shRNA shRNA Plasmid DNA
endogenous Bornavirus-like nucleoprotein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018029.3-1446s21c1
Sequence:CCGGCACGAATGTTCCCAAACTTAGCTCGAGCTAAGTTTGGGAACATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-538s21c1
Sequence:CCGGGAATTAAGTCGGAACCAATTTCTCGAGAAATTGGTTCCGACTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-1061s21c1
Sequence:CCGGAGGCAATGATGGCATCTATTGCTCGAGCAATAGATGCCATCATTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-1161s21c1
Sequence:CCGGACCGTGGGTTGGAGAATTAATCTCGAGATTAATTCTCCAACCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018029.3-1246s1c1
Sequence:CCGGCCAAGAAAGCACAGATGACAACTCGAGTTGTCATCTGTGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-921s1c1
Sequence:CCGGCAGATTCAAAGATATGCCTAACTCGAGTTAGGCATATCTTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-920s1c1
Sequence:CCGGGCAGATTCAAAGATATGCCTACTCGAGTAGGCATATCTTTGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-1006s1c1
Sequence:CCGGGCTGGATCAAGTGATAAGATTCTCGAGAATCTTATCACTTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018029
EBLN2 MISSION shRNA Lentiviral Transduction Particles
endogenous Bornavirus-like nucleoprotein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018029.3-1446s21c1
Sequence:CCGGCACGAATGTTCCCAAACTTAGCTCGAGCTAAGTTTGGGAACATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-538s21c1
Sequence:CCGGGAATTAAGTCGGAACCAATTTCTCGAGAAATTGGTTCCGACTTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-1061s21c1
Sequence:CCGGAGGCAATGATGGCATCTATTGCTCGAGCAATAGATGCCATCATTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018029.3-1161s21c1
Sequence:CCGGACCGTGGGTTGGAGAATTAATCTCGAGATTAATTCTCCAACCCACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018029.3-1246s1c1
Sequence:CCGGCCAAGAAAGCACAGATGACAACTCGAGTTGTCATCTGTGCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-921s1c1
Sequence:CCGGCAGATTCAAAGATATGCCTAACTCGAGTTAGGCATATCTTTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-920s1c1
Sequence:CCGGGCAGATTCAAAGATATGCCTACTCGAGTAGGCATATCTTTGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018029.3-1006s1c1
Sequence:CCGGGCTGGATCAAGTGATAAGATTCTCGAGAATCTTATCACTTGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks