EMAIL THIS PAGE TO A FRIEND

EBNA1BP2

EBNA1 binding protein 2

61 Gene Product Result for
Synonyms: EBP2 NOBP P40
UniProtKB ID: Q99848, Q96A66
Gene ID:
Mouse(69072) EBNA1 binding protein 2
Rat(114021) EBNA1 binding protein 2
sheep(101105871) EBNA1 binding protein 2
naked mole-rat(101702328) EBNA1 binding protein 2
domestic guinea pig(100728476) EBNA1 binding protein 2
Zebrafish(335049) EBNA1 binding protein 2
dog(475391) EBNA1 binding protein 2
cow(512041) EBNA1 binding protein 2
domestic cat(101096498) EBNA1 binding protein 2
chicken(424558) EBNA1 binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006824 Rosetta Predictions human pricing
NM_001008721 Rosetta Predictions rat pricing
NM_026932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074153 predicted 846
2 SASI_Hs01_00074154 predicted 1094
3 SASI_Hs01_00074155 predicted 992
4 SASI_Hs01_00074158 predicted 403
5 SASI_Hs01_00074159 predicted 717
6 SASI_Hs01_00074160 predicted 1093
7 SASI_Hs01_00074161 predicted 566
8 SASI_Hs01_00074162 predicted 522
9 SASI_Hs02_00342377 predicted 712
10 SASI_Hs02_00342378 predicted 634
11 SASI_Hs01_00074156 predicted 731
12 SASI_Hs01_00074157 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089067 predicted 337
2 SASI_Rn01_00089068 predicted 766
3 SASI_Rn01_00089069 predicted 780
4 SASI_Rn01_00089070 predicted 301
5 SASI_Rn01_00089071 predicted 780
6 SASI_Rn01_00089073 predicted 253
7 SASI_Rn01_00089074 predicted 311
8 SASI_Rn01_00089075 predicted 587
9 SASI_Rn01_00089076 predicted 571
10 SASI_Rn02_00199246 predicted 264
11 SASI_Rn01_00089072 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097512 predicted 804
2 SASI_Mm01_00097513 predicted 533
3 SASI_Mm01_00097514 predicted 399
4 SASI_Mm01_00097515 predicted 816
5 SASI_Mm01_00097516 predicted 389
6 SASI_Mm01_00097518 predicted 715
7 SASI_Mm01_00097519 predicted 686
8 SASI_Mm01_00097520 predicted 609
9 SASI_Mm01_00097521 predicted 890
10 SASI_Mm02_00331226 predicted 613
11 SASI_Mm01_00097517 predicted 658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026932
VALIDATED
EBNA1BP2 MISSION shRNA Bacterial Glycerol Stock
EBNA1 binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026932.2-1696s1c1
Sequence:CCGGCGACTTTAATTTGACTGGTATCTCGAGATACCAGTCAAATTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026932.2-809s1c1
Sequence:CCGGGCAGATGAGTAAAGGGCCTAACTCGAGTTAGGCCCTTTACTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-387s1c1
Sequence:CCGGGACCAGAAGAAAGGCGTTAATCTCGAGATTAACGCCTTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-632s1c1
Sequence:CCGGGCTTAGGAAATATGGAAAGAACTCGAGTTCTTTCCATATTTCCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-216s1c1
Sequence:CCGGCCAGGTCTCAATGTCGTGCTACTCGAGTAGCACGACATTGAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-387s21c1
Sequence:CCGGGACCAGAAGAAAGGCGTTAATCTCGAGATTAACGCCTTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-825s21c1
Sequence:CCGGCCTAATGCCAAACGAAGATACCTCGAGGTATCTTCGTTTGGCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-1037s21c1
Sequence:CCGGAGTAGCATCATCTTCTATAAACTCGAGTTTATAGAAGATGATGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026932.3-1145s21c1
Sequence:CCGGGAAAGATACTCTTGGGTTAAACTCGAGTTTAACCCAAGAGTATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-504s21c1
Sequence:CCGGACGAAGAGGCCCACCGATTATCTCGAGATAATCGGTGGGCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026932
VALIDATED
EBNA1BP2 MISSION shRNA shRNA Plasmid DNA
EBNA1 binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026932.2-1696s1c1
Sequence:CCGGCGACTTTAATTTGACTGGTATCTCGAGATACCAGTCAAATTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026932.2-809s1c1
Sequence:CCGGGCAGATGAGTAAAGGGCCTAACTCGAGTTAGGCCCTTTACTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-387s1c1
Sequence:CCGGGACCAGAAGAAAGGCGTTAATCTCGAGATTAACGCCTTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-632s1c1
Sequence:CCGGGCTTAGGAAATATGGAAAGAACTCGAGTTCTTTCCATATTTCCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-216s1c1
Sequence:CCGGCCAGGTCTCAATGTCGTGCTACTCGAGTAGCACGACATTGAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-387s21c1
Sequence:CCGGGACCAGAAGAAAGGCGTTAATCTCGAGATTAACGCCTTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-825s21c1
Sequence:CCGGCCTAATGCCAAACGAAGATACCTCGAGGTATCTTCGTTTGGCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-1037s21c1
Sequence:CCGGAGTAGCATCATCTTCTATAAACTCGAGTTTATAGAAGATGATGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026932.3-1145s21c1
Sequence:CCGGGAAAGATACTCTTGGGTTAAACTCGAGTTTAACCCAAGAGTATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-504s21c1
Sequence:CCGGACGAAGAGGCCCACCGATTATCTCGAGATAATCGGTGGGCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026932
VALIDATED
EBNA1BP2 MISSION shRNA Lentiviral Transduction Particles
EBNA1 binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026932.2-1696s1c1
Sequence:CCGGCGACTTTAATTTGACTGGTATCTCGAGATACCAGTCAAATTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026932.2-809s1c1
Sequence:CCGGGCAGATGAGTAAAGGGCCTAACTCGAGTTAGGCCCTTTACTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-387s1c1
Sequence:CCGGGACCAGAAGAAAGGCGTTAATCTCGAGATTAACGCCTTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-632s1c1
Sequence:CCGGGCTTAGGAAATATGGAAAGAACTCGAGTTCTTTCCATATTTCCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026932.2-216s1c1
Sequence:CCGGCCAGGTCTCAATGTCGTGCTACTCGAGTAGCACGACATTGAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-387s21c1
Sequence:CCGGGACCAGAAGAAAGGCGTTAATCTCGAGATTAACGCCTTTCTTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-825s21c1
Sequence:CCGGCCTAATGCCAAACGAAGATACCTCGAGGTATCTTCGTTTGGCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-1037s21c1
Sequence:CCGGAGTAGCATCATCTTCTATAAACTCGAGTTTATAGAAGATGATGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026932.3-1145s21c1
Sequence:CCGGGAAAGATACTCTTGGGTTAAACTCGAGTTTAACCCAAGAGTATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026932.3-504s21c1
Sequence:CCGGACGAAGAGGCCCACCGATTATCTCGAGATAATCGGTGGGCCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006824
VALIDATED
EBNA1BP2 MISSION shRNA Bacterial Glycerol Stock
EBNA1 binding protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-404s1c1
Sequence:CCGGCCTCAGAACAAGGACCAGAAACTCGAGTTTCTGGTCCTTGTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-852s1c1
Sequence:CCGGCCAGTGCTAAACGACGGTATACTCGAGTATACCGTCGTTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-851s1c1
Sequence:CCGGCCCAGTGCTAAACGACGGTATCTCGAGATACCGTCGTTTAGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-719s1c1
Sequence:CCGGGCCCATATGATGAATGCTATTCTCGAGAATAGCATTCATCATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-852s21c1
Sequence:CCGGCCAGTGCTAAACGACGGTATACTCGAGTATACCGTCGTTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.2-1048s21c1
Sequence:CCGGCTGGCAAGAAAGGGTCAAATACTCGAGTATTTGACCCTTTCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006824.1-1109s21c1
Sequence:CCGGCGCAATTTCACGACACACTTTCTCGAGAAAGTGTGTCGTGAAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006824.1-851s21c1
Sequence:CCGGCCCAGTGCTAAACGACGGTATCTCGAGATACCGTCGTTTAGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-1109s1c2
Sequence:CCGGCGCAATTTCACGACACACTTTCTCGAGAAAGTGTGTCGTGAAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-992s21c1
Sequence:CCGGCCTGGCAAGAAAGGGTCAAATCTCGAGATTTGACCCTTTCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-169s21c1
Sequence:CCGGGGAGTCGGAATCCGATGAATCCTCGAGGATTCATCGGATTCCGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-532s21c1
Sequence:CCGGGAAGCGACCCACTGATTATTTCTCGAGAAATAATCAGTGGGTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006824
VALIDATED
EBNA1BP2 MISSION shRNA shRNA Plasmid DNA
EBNA1 binding protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-404s1c1
Sequence:CCGGCCTCAGAACAAGGACCAGAAACTCGAGTTTCTGGTCCTTGTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-852s1c1
Sequence:CCGGCCAGTGCTAAACGACGGTATACTCGAGTATACCGTCGTTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-851s1c1
Sequence:CCGGCCCAGTGCTAAACGACGGTATCTCGAGATACCGTCGTTTAGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-719s1c1
Sequence:CCGGGCCCATATGATGAATGCTATTCTCGAGAATAGCATTCATCATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-852s21c1
Sequence:CCGGCCAGTGCTAAACGACGGTATACTCGAGTATACCGTCGTTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.2-1048s21c1
Sequence:CCGGCTGGCAAGAAAGGGTCAAATACTCGAGTATTTGACCCTTTCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006824.1-1109s21c1
Sequence:CCGGCGCAATTTCACGACACACTTTCTCGAGAAAGTGTGTCGTGAAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006824.1-851s21c1
Sequence:CCGGCCCAGTGCTAAACGACGGTATCTCGAGATACCGTCGTTTAGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-1109s1c2
Sequence:CCGGCGCAATTTCACGACACACTTTCTCGAGAAAGTGTGTCGTGAAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-992s21c1
Sequence:CCGGCCTGGCAAGAAAGGGTCAAATCTCGAGATTTGACCCTTTCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-169s21c1
Sequence:CCGGGGAGTCGGAATCCGATGAATCCTCGAGGATTCATCGGATTCCGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-532s21c1
Sequence:CCGGGAAGCGACCCACTGATTATTTCTCGAGAAATAATCAGTGGGTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006824
VALIDATED
EBNA1BP2 MISSION shRNA Lentiviral Transduction Particles
EBNA1 binding protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-404s1c1
Sequence:CCGGCCTCAGAACAAGGACCAGAAACTCGAGTTTCTGGTCCTTGTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-852s1c1
Sequence:CCGGCCAGTGCTAAACGACGGTATACTCGAGTATACCGTCGTTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-851s1c1
Sequence:CCGGCCCAGTGCTAAACGACGGTATCTCGAGATACCGTCGTTTAGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-719s1c1
Sequence:CCGGGCCCATATGATGAATGCTATTCTCGAGAATAGCATTCATCATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-852s21c1
Sequence:CCGGCCAGTGCTAAACGACGGTATACTCGAGTATACCGTCGTTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.2-1048s21c1
Sequence:CCGGCTGGCAAGAAAGGGTCAAATACTCGAGTATTTGACCCTTTCTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006824.1-1109s21c1
Sequence:CCGGCGCAATTTCACGACACACTTTCTCGAGAAAGTGTGTCGTGAAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006824.1-851s21c1
Sequence:CCGGCCCAGTGCTAAACGACGGTATCTCGAGATACCGTCGTTTAGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006824.1-1109s1c2
Sequence:CCGGCGCAATTTCACGACACACTTTCTCGAGAAAGTGTGTCGTGAAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-992s21c1
Sequence:CCGGCCTGGCAAGAAAGGGTCAAATCTCGAGATTTGACCCTTTCTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-169s21c1
Sequence:CCGGGGAGTCGGAATCCGATGAATCCTCGAGGATTCATCGGATTCCGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006824.1-532s21c1
Sequence:CCGGGAAGCGACCCACTGATTATTTCTCGAGAAATAATCAGTGGGTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks