EMAIL THIS PAGE TO A FRIEND

EBP

emopamil binding protein (sterol isomerase)

74 Gene Product Result for
Synonyms: CDPX2 CHO2 CPX CPXD
UniProtKB ID: Q15125, Q6FGL3, Q6IBI9
Gene ID:
Human(10682) Summary: The protein encoded by this gene is an integral membrane protein of the endoplasmic reticulum. It is a high affinity binding protein for the antiischemic phenylalkylamine Ca2+ antagonist [3H]
Mouse(13595) phenylalkylamine Ca2+ antagonist (emopamil) binding protein
Rat(117278) emopamil binding protein (sterol isomerase)
sheep(101112029) emopamil binding protein (sterol isomerase)
domestic guinea pig(100135518) phenylalkylamine Ca2+ antagonist (emopamil) binding protein
naked mole-rat(101701732) emopamil binding protein (sterol isomerase)
Zebrafish(436600) emopamil binding protein (sterol isomerase)
Thale Cress(820929) ethylene-responsive transcription factor RAP2-3
dog(609430) emopamil binding protein (sterol isomerase)
cow(515569) emopamil binding protein (sterol isomerase)
domestic cat(101094572) emopamil binding protein (sterol isomerase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108600 Anti-EBP affinity isolated antibody mouse, pig, horse, bovine, rat, rabbit, human, guinea pig, canine
western blot pricing
HPA003130 Anti-EBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV46742 Anti-EBP antibody produced in rabbit affinity isolated antibody pig, horse, bovine, mouse, guinea pig, human, rabbit, canine, rat
western blot pricing
SAB1307221 ANTI-EBP(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006579 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014361 MISSION® esiRNA esiRNA targeting human EBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006579 Rosetta Predictions human pricing
NM_057137 Rosetta Predictions rat pricing
NM_007898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162786 predicted 526
2 SASI_Hs01_00162788 predicted 527
3 SASI_Hs01_00162789 predicted 445
4 SASI_Hs02_00341869 predicted 485
5 SASI_Hs01_00162790 predicted 824
6 SASI_Hs01_00162792 predicted 475
7 SASI_Hs02_00341870 predicted 391
8 SASI_Hs01_00162793 predicted 588
9 SASI_Hs01_00162794 predicted 665
10 SASI_Hs01_00162795 predicted 537
11 SASI_Hs01_00162787 predicted 354
12 SASI_Hs01_00162791 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037798 predicted 428
2 SASI_Rn01_00037799 predicted 350
3 SASI_Rn02_00267089 predicted 254
4 SASI_Rn01_00037800 predicted 523
5 SASI_Rn01_00037801 predicted 224
6 SASI_Rn01_00037802 predicted 394
7 SASI_Rn02_00267090 predicted 553
8 SASI_Rn01_00037804 predicted 396
9 SASI_Rn01_00037805 predicted 448
10 SASI_Rn01_00037806 predicted 607
11 SASI_Rn01_00037803 predicted 238
12 SASI_Rn01_00037807 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180849 predicted 1090
2 SASI_Mm01_00180850 predicted 1086
3 SASI_Mm01_00180851 predicted 1159
4 SASI_Mm01_00180852 predicted 846
5 SASI_Mm01_00180853 predicted 917
6 SASI_Mm01_00180855 predicted 1193
7 SASI_Mm02_00312687 predicted 1446
8 SASI_Mm01_00180856 predicted 1188
9 SASI_Mm01_00180857 predicted 1219
10 SASI_Mm02_00312688 predicted 1106
11 SASI_Mm01_00180848 predicted 1050
12 SASI_Mm01_00180854 predicted 975
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007898
VALIDATED
EBP MISSION shRNA Bacterial Glycerol Stock
emopamil binding protein (sterol isomerase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1083s21c1
Sequence:CCGGCCAAGGGAGATAGCCGATATACTCGAGTATATCGGCTATCTCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1443s21c1
Sequence:CCGGTTAAGAGCAAGCATAACTAAACTCGAGTTTAGTTATGCTTGCTCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007898.2-1514s21c1
Sequence:CCGGCCAGAAGACTCAAATCTTCTTCTCGAGAAGAAGATTTGAGTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1229s21c1
Sequence:CCGGGTGTCTATGGGCCAGATATACCTCGAGGTATATCTGGCCCATAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1514s1c1
Sequence:CCGGCCAGAAGACTCAAATCTTCTTCTCGAGAAGAAGATTTGAGTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007898.2-1169s1c1
Sequence:CCGGCTATGGGTAGTGATTGCCTTTCTCGAGAAAGGCAATCACTACCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007898.2-1313s1c1
Sequence:CCGGCCCGTTTATTTCTGGTTCTATCTCGAGATAGAACCAGAAATAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1083s1c1
Sequence:CCGGCCAAGGGAGATAGCCGATATACTCGAGTATATCGGCTATCTCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1084s1c1
Sequence:CCGGCAAGGGAGATAGCCGATATATCTCGAGATATATCGGCTATCTCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007898
VALIDATED
EBP MISSION shRNA shRNA Plasmid DNA
emopamil binding protein (sterol isomerase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1083s21c1
Sequence:CCGGCCAAGGGAGATAGCCGATATACTCGAGTATATCGGCTATCTCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1443s21c1
Sequence:CCGGTTAAGAGCAAGCATAACTAAACTCGAGTTTAGTTATGCTTGCTCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007898.2-1514s21c1
Sequence:CCGGCCAGAAGACTCAAATCTTCTTCTCGAGAAGAAGATTTGAGTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1229s21c1
Sequence:CCGGGTGTCTATGGGCCAGATATACCTCGAGGTATATCTGGCCCATAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1514s1c1
Sequence:CCGGCCAGAAGACTCAAATCTTCTTCTCGAGAAGAAGATTTGAGTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007898.2-1169s1c1
Sequence:CCGGCTATGGGTAGTGATTGCCTTTCTCGAGAAAGGCAATCACTACCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007898.2-1313s1c1
Sequence:CCGGCCCGTTTATTTCTGGTTCTATCTCGAGATAGAACCAGAAATAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1083s1c1
Sequence:CCGGCCAAGGGAGATAGCCGATATACTCGAGTATATCGGCTATCTCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1084s1c1
Sequence:CCGGCAAGGGAGATAGCCGATATATCTCGAGATATATCGGCTATCTCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007898
VALIDATED
EBP MISSION shRNA Lentiviral Transduction Particles
emopamil binding protein (sterol isomerase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1083s21c1
Sequence:CCGGCCAAGGGAGATAGCCGATATACTCGAGTATATCGGCTATCTCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1443s21c1
Sequence:CCGGTTAAGAGCAAGCATAACTAAACTCGAGTTTAGTTATGCTTGCTCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007898.2-1514s21c1
Sequence:CCGGCCAGAAGACTCAAATCTTCTTCTCGAGAAGAAGATTTGAGTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007898.2-1229s21c1
Sequence:CCGGGTGTCTATGGGCCAGATATACCTCGAGGTATATCTGGCCCATAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1514s1c1
Sequence:CCGGCCAGAAGACTCAAATCTTCTTCTCGAGAAGAAGATTTGAGTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007898.2-1169s1c1
Sequence:CCGGCTATGGGTAGTGATTGCCTTTCTCGAGAAAGGCAATCACTACCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007898.2-1313s1c1
Sequence:CCGGCCCGTTTATTTCTGGTTCTATCTCGAGATAGAACCAGAAATAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1083s1c1
Sequence:CCGGCCAAGGGAGATAGCCGATATACTCGAGTATATCGGCTATCTCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007898.2-1084s1c1
Sequence:CCGGCAAGGGAGATAGCCGATATATCTCGAGATATATCGGCTATCTCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006579
VALIDATED
EBP MISSION shRNA Bacterial Glycerol Stock
emopamil binding protein (sterol isomerase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-454s21c1
Sequence:CCGGCGTTCTCTACTACGAAGACCTCTCGAGAGGTCTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-257s21c1
Sequence:CCGGCTGGACAACTTTGTACCTAATCTCGAGATTAGGTACAAAGTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-746s21c1
Sequence:CCGGCACCCTCTCTACTTCTGGTTTCTCGAGAAACCAGAAGTAGAGAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-247s21c1
Sequence:CCGGGCACCTAAGACTGGACAACTTCTCGAGAAGTTGTCCAGTCTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006579.1-153s1c1
Sequence:CCGGGCACCTAAGACTGGACAACTTCTCGAGAAGTTGTCCAGTCTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-652s1c1
Sequence:CCGGCACCCTCTCTACTTCTGGTTTCTCGAGAAACCAGAAGTAGAGAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-163s1c1
Sequence:CCGGCTGGACAACTTTGTACCTAATCTCGAGATTAGGTACAAAGTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-360s1c1
Sequence:CCGGCGTTCTCTACTACGAAGACCTCTCGAGAGGTCTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006579.1-547s1c1
Sequence:CCGGCTCCGCTTCATTCTACAGCTTCTCGAGAAGCTGTAGAATGAAGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006579
VALIDATED
EBP MISSION shRNA shRNA Plasmid DNA
emopamil binding protein (sterol isomerase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-454s21c1
Sequence:CCGGCGTTCTCTACTACGAAGACCTCTCGAGAGGTCTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-257s21c1
Sequence:CCGGCTGGACAACTTTGTACCTAATCTCGAGATTAGGTACAAAGTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-746s21c1
Sequence:CCGGCACCCTCTCTACTTCTGGTTTCTCGAGAAACCAGAAGTAGAGAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-247s21c1
Sequence:CCGGGCACCTAAGACTGGACAACTTCTCGAGAAGTTGTCCAGTCTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006579.1-153s1c1
Sequence:CCGGGCACCTAAGACTGGACAACTTCTCGAGAAGTTGTCCAGTCTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-652s1c1
Sequence:CCGGCACCCTCTCTACTTCTGGTTTCTCGAGAAACCAGAAGTAGAGAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-163s1c1
Sequence:CCGGCTGGACAACTTTGTACCTAATCTCGAGATTAGGTACAAAGTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-360s1c1
Sequence:CCGGCGTTCTCTACTACGAAGACCTCTCGAGAGGTCTTCGTAGTAGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006579.1-547s1c1
Sequence:CCGGCTCCGCTTCATTCTACAGCTTCTCGAGAAGCTGTAGAATGAAGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006579
VALIDATED
EBP MISSION shRNA Lentiviral Transduction Particles
emopamil binding protein (sterol isomerase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-454s21c1
Sequence:CCGGCGTTCTCTACTACGAAGACCTCTCGAGAGGTCTTCGTAGTAGAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-257s21c1
Sequence:CCGGCTGGACAACTTTGTACCTAATCTCGAGATTAGGTACAAAGTTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-746s21c1
Sequence:CCGGCACCCTCTCTACTTCTGGTTTCTCGAGAAACCAGAAGTAGAGAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006579.2-247s21c1
Sequence:CCGGGCACCTAAGACTGGACAACTTCTCGAGAAGTTGTCCAGTCTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006579.1-153s1c1
Sequence:CCGGGCACCTAAGACTGGACAACTTCTCGAGAAGTTGTCCAGTCTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-652s1c1
Sequence:CCGGCACCCTCTCTACTTCTGGTTTCTCGAGAAACCAGAAGTAGAGAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-163s1c1
Sequence:CCGGCTGGACAACTTTGTACCTAATCTCGAGATTAGGTACAAAGTTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006579.1-360s1c1
Sequence:CCGGCGTTCTCTACTACGAAGACCTCTCGAGAGGTCTTCGTAGTAGAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006579.1-547s1c1
Sequence:CCGGCTCCGCTTCATTCTACAGCTTCTCGAGAAGCTGTAGAATGAAGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)