EMAIL THIS PAGE TO A FRIEND

EBPL

emopamil binding protein-like

56 Gene Product Result for
Synonyms: EBRP
Gene ID:
Mouse(68177) emopamil binding protein-like
Rat(361054) emopamil binding protein-like
Zebrafish(768138) emopamil binding protein-like
dog(476910) emopamil binding protein-like
cow(512958) emopamil binding protein-like
domestic cat(101099609) emopamil binding protein-like
naked mole-rat(101723794) emopamil binding protein-like
domestic guinea pig(100717968) emopamil binding protein-like
sheep(101117596) emopamil binding protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032565 Rosetta Predictions human pricing
XM_001063508 Rosetta Predictions rat pricing
XM_341334 Rosetta Predictions rat pricing
NM_026598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068909 predicted 477
2 SASI_Hs01_00068911 predicted 688
3 SASI_Hs01_00068912 predicted 278
4 SASI_Hs01_00068914 predicted 274
5 SASI_Hs01_00068917 predicted 653
6 SASI_Hs01_00068918 predicted 675
7 SASI_Hs02_00360079 predicted 652
8 SASI_Hs02_00360080 predicted 626
9 SASI_Hs01_00068910 predicted 304
10 SASI_Hs01_00068913 predicted 679
11 SASI_Hs01_00068915 predicted 376
12 SASI_Hs01_00068916 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307381 predicted 542
2 SASI_Rn02_00307382 predicted 274
3 SASI_Rn02_00307383 predicted 401
4 SASI_Rn02_00307384 predicted 336
5 SASI_Rn02_00307385 predicted 886
6 SASI_Rn02_00307386 predicted 924
7 SASI_Rn02_00307387 predicted 891
8 SASI_Rn02_00307388 predicted 540
9 SASI_Rn02_00307389 predicted 459
10 SASI_Rn02_00307390 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392758 predicted 546
2 SASI_Rn02_00392759 predicted 272
3 SASI_Rn02_00392760 predicted 403
4 SASI_Rn02_00392761 predicted 332
5 SASI_Rn02_00392762 predicted 889
6 SASI_Rn02_00392763 predicted 924
7 SASI_Rn02_00392764 predicted 888
8 SASI_Rn02_00392765 predicted 538
9 SASI_Rn02_00392766 predicted 457
10 SASI_Rn02_00392767 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116027 predicted 312
2 SASI_Mm01_00116028 predicted 399
3 SASI_Mm01_00116029 predicted 301
4 SASI_Mm02_00330559 predicted 271
5 SASI_Mm01_00116030 predicted 276
6 SASI_Mm01_00116031 predicted 316
7 SASI_Mm01_00116032 predicted 227
8 SASI_Mm01_00116033 predicted 432
9 SASI_Mm01_00116035 predicted 282
10 SASI_Mm01_00116036 predicted 277
11 SASI_Mm01_00116034 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032565
EBPL MISSION shRNA Bacterial Glycerol Stock
emopamil binding protein-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032565.1-754s1c1
Sequence:CCGGCATTCCAGTCTACACTTTGTTCTCGAGAACAAAGTGTAGACTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-311s1c1
Sequence:CCGGGCTGATGCAAGATGGGTTTATCTCGAGATAAACCCATCTTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-397s1c1
Sequence:CCGGCCTCATTTATGCCATAGTCAACTCGAGTTGACTATGGCATAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-271s1c1
Sequence:CCGGCGATGGCTTGATTGCTTCTTTCTCGAGAAAGAAGCAATCAAGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-338s1c1
Sequence:CCGGCCAACCATTGTGTCTGTGGAACTCGAGTTCCACAGACACAATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032565
EBPL MISSION shRNA shRNA Plasmid DNA
emopamil binding protein-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032565.1-754s1c1
Sequence:CCGGCATTCCAGTCTACACTTTGTTCTCGAGAACAAAGTGTAGACTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-311s1c1
Sequence:CCGGGCTGATGCAAGATGGGTTTATCTCGAGATAAACCCATCTTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-397s1c1
Sequence:CCGGCCTCATTTATGCCATAGTCAACTCGAGTTGACTATGGCATAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-271s1c1
Sequence:CCGGCGATGGCTTGATTGCTTCTTTCTCGAGAAAGAAGCAATCAAGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-338s1c1
Sequence:CCGGCCAACCATTGTGTCTGTGGAACTCGAGTTCCACAGACACAATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032565
EBPL MISSION shRNA Lentiviral Transduction Particles
emopamil binding protein-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032565.1-754s1c1
Sequence:CCGGCATTCCAGTCTACACTTTGTTCTCGAGAACAAAGTGTAGACTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-311s1c1
Sequence:CCGGGCTGATGCAAGATGGGTTTATCTCGAGATAAACCCATCTTGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-397s1c1
Sequence:CCGGCCTCATTTATGCCATAGTCAACTCGAGTTGACTATGGCATAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-271s1c1
Sequence:CCGGCGATGGCTTGATTGCTTCTTTCTCGAGAAAGAAGCAATCAAGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032565.1-338s1c1
Sequence:CCGGCCAACCATTGTGTCTGTGGAACTCGAGTTCCACAGACACAATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026598
EBPL MISSION shRNA Bacterial Glycerol Stock
emopamil binding protein-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026598.1-685s1c1
Sequence:CCGGCCCATTCTGACGATCTGCTTTCTCGAGAAAGCAGATCGTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-542s1c1
Sequence:CCGGCCTCTGGGTCTATTTGGTGTTCTCGAGAACACCAAATAGACCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-257s1c1
Sequence:CCGGTGTTGCAGATTCCCAAGGCTTCTCGAGAAGCCTTGGGAATCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-645s1c1
Sequence:CCGGGCTAATTTAGCGAAGAAGCATCTCGAGATGCTTCTTCGCTAAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-269s1c1
Sequence:CCGGCCAAGGCTTGATTGCATCTTTCTCGAGAAAGATGCAATCAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-337s21c1
Sequence:CCGGTGATCCCACCGTTGTGTCTTTCTCGAGAAAGACACAACGGTGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-315s21c1
Sequence:CCGGCTGACACAAGATGGCTGTATTCTCGAGAATACAGCCATCTTGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026598.3-991s21c1
Sequence:CCGGGGCTAGTTATGCCGTGTTAATCTCGAGATTAACACGGCATAACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-201s21c1
Sequence:CCGGACGACTCACTGGTTCACTTTGCTCGAGCAAAGTGAACCAGTGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026598
EBPL MISSION shRNA shRNA Plasmid DNA
emopamil binding protein-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026598.1-685s1c1
Sequence:CCGGCCCATTCTGACGATCTGCTTTCTCGAGAAAGCAGATCGTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-542s1c1
Sequence:CCGGCCTCTGGGTCTATTTGGTGTTCTCGAGAACACCAAATAGACCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-257s1c1
Sequence:CCGGTGTTGCAGATTCCCAAGGCTTCTCGAGAAGCCTTGGGAATCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-645s1c1
Sequence:CCGGGCTAATTTAGCGAAGAAGCATCTCGAGATGCTTCTTCGCTAAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-269s1c1
Sequence:CCGGCCAAGGCTTGATTGCATCTTTCTCGAGAAAGATGCAATCAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-337s21c1
Sequence:CCGGTGATCCCACCGTTGTGTCTTTCTCGAGAAAGACACAACGGTGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-315s21c1
Sequence:CCGGCTGACACAAGATGGCTGTATTCTCGAGAATACAGCCATCTTGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026598.3-991s21c1
Sequence:CCGGGGCTAGTTATGCCGTGTTAATCTCGAGATTAACACGGCATAACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-201s21c1
Sequence:CCGGACGACTCACTGGTTCACTTTGCTCGAGCAAAGTGAACCAGTGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026598
EBPL MISSION shRNA Lentiviral Transduction Particles
emopamil binding protein-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026598.1-685s1c1
Sequence:CCGGCCCATTCTGACGATCTGCTTTCTCGAGAAAGCAGATCGTCAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-542s1c1
Sequence:CCGGCCTCTGGGTCTATTTGGTGTTCTCGAGAACACCAAATAGACCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-257s1c1
Sequence:CCGGTGTTGCAGATTCCCAAGGCTTCTCGAGAAGCCTTGGGAATCTGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-645s1c1
Sequence:CCGGGCTAATTTAGCGAAGAAGCATCTCGAGATGCTTCTTCGCTAAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026598.1-269s1c1
Sequence:CCGGCCAAGGCTTGATTGCATCTTTCTCGAGAAAGATGCAATCAAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-337s21c1
Sequence:CCGGTGATCCCACCGTTGTGTCTTTCTCGAGAAAGACACAACGGTGGGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-315s21c1
Sequence:CCGGCTGACACAAGATGGCTGTATTCTCGAGAATACAGCCATCTTGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026598.3-991s21c1
Sequence:CCGGGGCTAGTTATGCCGTGTTAATCTCGAGATTAACACGGCATAACTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026598.3-201s21c1
Sequence:CCGGACGACTCACTGGTTCACTTTGCTCGAGCAAAGTGAACCAGTGAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks