EMAIL THIS PAGE TO A FRIEND

ECD

ecdysoneless homolog (Drosophila)

Synonyms: GCR2 HSGT1
UniProtKB ID: O95905, C9JX46, E9PAW8
Gene ID:
Mouse(70601) ecdysoneless homolog (Drosophila)
Zebrafish(100003562) ecdysoneless homolog (Drosophila)
cow(524184) ecdysoneless homolog (Drosophila)
Horse(100063816) ecdysoneless homolog (Drosophila)
domestic cat(101084483) ecdysoneless homolog (Drosophila)
dog(479244) ecdysoneless homolog (Drosophila)
chicken(423638) ecdysoneless homolog (Drosophila)
fruit fly(38291) ecdysoneless
Goat(100861083) ecdysoneless homolog (Drosophila)
Domestic Rabbit(100339840) ecdysoneless homolog (Drosophila)
sheep(101117214) ecdysoneless homolog (Drosophila)
domestic guinea pig(100725045) ecdysoneless homolog (Drosophila)
naked mole-rat(101704791) ecdysoneless homolog (Drosophila)
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007265 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007265 Rosetta Predictions human pricing
NM_027475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238565 predicted 1109
2 SASI_Hs01_00238566 predicted 1366
3 SASI_Hs01_00238567 predicted 967
4 SASI_Hs01_00238568 predicted 504
5 SASI_Hs01_00238571 predicted 1372
6 SASI_Hs02_00343299 predicted 1261
7 SASI_Hs01_00238572 predicted 671
8 SASI_Hs01_00238573 predicted 1401
9 SASI_Hs02_00343300 predicted 1288
10 SASI_Hs01_00238574 predicted 1544
11 SASI_Hs01_00238569 predicted 1448
12 SASI_Hs01_00238570 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332280 predicted 1093
2 SASI_Mm02_00332281 predicted 1453
3 SASI_Mm02_00332282 predicted 1269
4 SASI_Mm02_00332283 predicted 1353
5 SASI_Mm02_00332284 predicted 2096
6 SASI_Mm02_00332285 predicted 1496
7 SASI_Mm02_00332286 predicted 337
8 SASI_Mm02_00332287 predicted 977
9 SASI_Mm02_00332288 predicted 1228
10 SASI_Mm02_00332289 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027475
ECD MISSION shRNA Bacterial Glycerol Stock
ecdysoneless homolog (Drosophila)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-504s21c1
Sequence:CCGGATCAGCCTTTCAATCTCAAATCTCGAGATTTGAGATTGAAAGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-475s21c1
Sequence:CCGGACCCATACTGGTCCCTTATATCTCGAGATATAAGGGACCAGTATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2573s21c1
Sequence:CCGGCGGAATCTCCATTGTAGTAAACTCGAGTTTACTACAATGGAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-442s21c1
Sequence:CCGGGAAGTACATTGAACGGATAATCTCGAGATTATCCGTTCAATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-1113s21c1
Sequence:CCGGCCTCGGTCACTTTCACGAAATCTCGAGATTTCGTGAAAGTGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-587s21c1
Sequence:CCGGATTGAGGATGAATGGTTTATTCTCGAGAATAAACCATTCATCCTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-2118s21c1
Sequence:CCGGATGTAGACCTGAACCTGATTTCTCGAGAAATCAGGTTCAGGTCTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2748s21c1
Sequence:CCGGCATTCTGCACGCGCTCCTAATCTCGAGATTAGGAGCGCGTGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2601s21c1
Sequence:CCGGGCTGTTGGCTGTTGGTGTAATCTCGAGATTACACCAACAGCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-748s1c1
Sequence:CCGGGCCGAGGAAATCTGAAAGGATCTCGAGATCCTTTCAGATTTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027475.1-2244s1c1
Sequence:CCGGGCCACCCTTCTCAGGAATAAACTCGAGTTTATTCCTGAGAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1234s1c1
Sequence:CCGGCTCCAAATGTAGCCCACATTTCTCGAGAAATGTGGGCTACATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1417s1c1
Sequence:CCGGGCCAGAAAGTTCACTTGCTATCTCGAGATAGCAAGTGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1233s1c1
Sequence:CCGGGCTCCAAATGTAGCCCACATTCTCGAGAATGTGGGCTACATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027475
ECD MISSION shRNA shRNA Plasmid DNA
ecdysoneless homolog (Drosophila)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-504s21c1
Sequence:CCGGATCAGCCTTTCAATCTCAAATCTCGAGATTTGAGATTGAAAGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-475s21c1
Sequence:CCGGACCCATACTGGTCCCTTATATCTCGAGATATAAGGGACCAGTATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2573s21c1
Sequence:CCGGCGGAATCTCCATTGTAGTAAACTCGAGTTTACTACAATGGAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-442s21c1
Sequence:CCGGGAAGTACATTGAACGGATAATCTCGAGATTATCCGTTCAATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-1113s21c1
Sequence:CCGGCCTCGGTCACTTTCACGAAATCTCGAGATTTCGTGAAAGTGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-587s21c1
Sequence:CCGGATTGAGGATGAATGGTTTATTCTCGAGAATAAACCATTCATCCTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-2118s21c1
Sequence:CCGGATGTAGACCTGAACCTGATTTCTCGAGAAATCAGGTTCAGGTCTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2748s21c1
Sequence:CCGGCATTCTGCACGCGCTCCTAATCTCGAGATTAGGAGCGCGTGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2601s21c1
Sequence:CCGGGCTGTTGGCTGTTGGTGTAATCTCGAGATTACACCAACAGCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-748s1c1
Sequence:CCGGGCCGAGGAAATCTGAAAGGATCTCGAGATCCTTTCAGATTTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027475.1-2244s1c1
Sequence:CCGGGCCACCCTTCTCAGGAATAAACTCGAGTTTATTCCTGAGAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1234s1c1
Sequence:CCGGCTCCAAATGTAGCCCACATTTCTCGAGAAATGTGGGCTACATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1417s1c1
Sequence:CCGGGCCAGAAAGTTCACTTGCTATCTCGAGATAGCAAGTGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1233s1c1
Sequence:CCGGGCTCCAAATGTAGCCCACATTCTCGAGAATGTGGGCTACATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027475
ECD MISSION shRNA Lentiviral Transduction Particles
ecdysoneless homolog (Drosophila)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-504s21c1
Sequence:CCGGATCAGCCTTTCAATCTCAAATCTCGAGATTTGAGATTGAAAGGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-475s21c1
Sequence:CCGGACCCATACTGGTCCCTTATATCTCGAGATATAAGGGACCAGTATGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2573s21c1
Sequence:CCGGCGGAATCTCCATTGTAGTAAACTCGAGTTTACTACAATGGAGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-442s21c1
Sequence:CCGGGAAGTACATTGAACGGATAATCTCGAGATTATCCGTTCAATGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-1113s21c1
Sequence:CCGGCCTCGGTCACTTTCACGAAATCTCGAGATTTCGTGAAAGTGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-587s21c1
Sequence:CCGGATTGAGGATGAATGGTTTATTCTCGAGAATAAACCATTCATCCTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027475.3-2118s21c1
Sequence:CCGGATGTAGACCTGAACCTGATTTCTCGAGAAATCAGGTTCAGGTCTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2748s21c1
Sequence:CCGGCATTCTGCACGCGCTCCTAATCTCGAGATTAGGAGCGCGTGCAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027475.3-2601s21c1
Sequence:CCGGGCTGTTGGCTGTTGGTGTAATCTCGAGATTACACCAACAGCCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-748s1c1
Sequence:CCGGGCCGAGGAAATCTGAAAGGATCTCGAGATCCTTTCAGATTTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027475.1-2244s1c1
Sequence:CCGGGCCACCCTTCTCAGGAATAAACTCGAGTTTATTCCTGAGAAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1234s1c1
Sequence:CCGGCTCCAAATGTAGCCCACATTTCTCGAGAAATGTGGGCTACATTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1417s1c1
Sequence:CCGGGCCAGAAAGTTCACTTGCTATCTCGAGATAGCAAGTGAACTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027475.1-1233s1c1
Sequence:CCGGGCTCCAAATGTAGCCCACATTCTCGAGAATGTGGGCTACATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007265
VALIDATED
ECD MISSION shRNA Bacterial Glycerol Stock
ecdysoneless homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-1958s21c1
Sequence:CCGGCCCAGACTACCGATAACAATTCTCGAGAATTGTTATCGGTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-1157s21c1
Sequence:CCGGCTCATGGATTTGAGATCTTATCTCGAGATAAGATCTCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007265.2-999s21c1
Sequence:CCGGCTTGCCTGAAACACGAATAATCTCGAGATTATTCGTGTTTCAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007265.2-550s21c1
Sequence:CCGGCCAGAGTTAGTAGCAAGGATTCTCGAGAATCCTTGCTACTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-411s21c1
Sequence:CCGGGAATCAGCCTTTCAATCTTAACTCGAGTTAAGATTGAAAGGCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-514s1c1
Sequence:CCGGCCAGAGTTAGTAGCAAGGATTCTCGAGAATCCTTGCTACTAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007265.1-1387s1c1
Sequence:CCGGCCATTTGATATAGAAGACCTTCTCGAGAAGGTCTTCTATATCAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007265.1-1096s1c1
Sequence:CCGGGCCCATGAATTGGGCATGAAACTCGAGTTTCATGCCCAATTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-1922s1c1
Sequence:CCGGCCCAGACTACCGATAACAATTCTCGAGAATTGTTATCGGTAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-699s1c1
Sequence:CCGGCCCAACAATTCCACAAGCATTCTCGAGAATGCTTGTGGAATTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007265
VALIDATED
ECD MISSION shRNA shRNA Plasmid DNA
ecdysoneless homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-1958s21c1
Sequence:CCGGCCCAGACTACCGATAACAATTCTCGAGAATTGTTATCGGTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-1157s21c1
Sequence:CCGGCTCATGGATTTGAGATCTTATCTCGAGATAAGATCTCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007265.2-999s21c1
Sequence:CCGGCTTGCCTGAAACACGAATAATCTCGAGATTATTCGTGTTTCAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007265.2-550s21c1
Sequence:CCGGCCAGAGTTAGTAGCAAGGATTCTCGAGAATCCTTGCTACTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-411s21c1
Sequence:CCGGGAATCAGCCTTTCAATCTTAACTCGAGTTAAGATTGAAAGGCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-514s1c1
Sequence:CCGGCCAGAGTTAGTAGCAAGGATTCTCGAGAATCCTTGCTACTAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007265.1-1387s1c1
Sequence:CCGGCCATTTGATATAGAAGACCTTCTCGAGAAGGTCTTCTATATCAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007265.1-1096s1c1
Sequence:CCGGGCCCATGAATTGGGCATGAAACTCGAGTTTCATGCCCAATTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-1922s1c1
Sequence:CCGGCCCAGACTACCGATAACAATTCTCGAGAATTGTTATCGGTAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-699s1c1
Sequence:CCGGCCCAACAATTCCACAAGCATTCTCGAGAATGCTTGTGGAATTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007265
VALIDATED
ECD MISSION shRNA Lentiviral Transduction Particles
ecdysoneless homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-1958s21c1
Sequence:CCGGCCCAGACTACCGATAACAATTCTCGAGAATTGTTATCGGTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-1157s21c1
Sequence:CCGGCTCATGGATTTGAGATCTTATCTCGAGATAAGATCTCAAATCCATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007265.2-999s21c1
Sequence:CCGGCTTGCCTGAAACACGAATAATCTCGAGATTATTCGTGTTTCAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007265.2-550s21c1
Sequence:CCGGCCAGAGTTAGTAGCAAGGATTCTCGAGAATCCTTGCTACTAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007265.2-411s21c1
Sequence:CCGGGAATCAGCCTTTCAATCTTAACTCGAGTTAAGATTGAAAGGCTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-514s1c1
Sequence:CCGGCCAGAGTTAGTAGCAAGGATTCTCGAGAATCCTTGCTACTAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007265.1-1387s1c1
Sequence:CCGGCCATTTGATATAGAAGACCTTCTCGAGAAGGTCTTCTATATCAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007265.1-1096s1c1
Sequence:CCGGGCCCATGAATTGGGCATGAAACTCGAGTTTCATGCCCAATTCATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-1922s1c1
Sequence:CCGGCCCAGACTACCGATAACAATTCTCGAGAATTGTTATCGGTAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007265.1-699s1c1
Sequence:CCGGCCCAACAATTCCACAAGCATTCTCGAGAATGCTTGTGGAATTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks