EMAIL THIS PAGE TO A FRIEND

ECE1

endothelin converting enzyme 1

94 Gene Product Result for
Synonyms: ECE
Gene ID:
Human(1889) Summary: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
Mouse(230857) endothelin converting enzyme 1
Rat(94204) endothelin converting enzyme 1
naked mole-rat(101724667) endothelin converting enzyme 1
domestic guinea pig(100719142) endothelin converting enzyme 1
sheep(443125) endothelin converting enzyme 1
Domestic Rabbit(100009445) endothelin converting enzyme 1
Zebrafish(777750) endothelin converting enzyme 1
cow(281133) endothelin converting enzyme 1
domestic cat(101093786) endothelin converting enzyme 1
dog(487388) endothelin converting enzyme 1
chicken(395459) endothelin converting enzyme 1
Zebrafish(793465) endothelin converting enzyme 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
B5181 7-Methoxycoumarin-4-acetyl [Ala7-(2,4-Dinitrophenyl)Lys9]-Bradykinin trifluoroacetate salt >94% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001397 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082101 MISSION® esiRNA esiRNA human ECE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113347 Rosetta Predictions human pricing
NM_001113348 Rosetta Predictions human pricing
NM_001113349 Rosetta Predictions human pricing
NM_001397 Rosetta Predictions human pricing
NM_053596 Rosetta Predictions rat pricing
NM_199307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325701 predicted 929
2 SASI_Hs02_00325702 predicted 740
3 SASI_Hs02_00325703 predicted 2497
4 SASI_Hs02_00325704 predicted 1919
5 SASI_Hs02_00325705 predicted 1370
6 SASI_Hs02_00325706 predicted 1476
7 SASI_Hs02_00325707 predicted 1296
8 SASI_Hs02_00325708 predicted 1343
9 SASI_Hs02_00325709 predicted 1355
10 SASI_Hs02_00325710 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325711 predicted 824
2 SASI_Hs02_00325712 predicted 632
3 SASI_Hs02_00325713 predicted 2392
4 SASI_Hs02_00325714 predicted 1808
5 SASI_Hs02_00325715 predicted 1261
6 SASI_Hs02_00325716 predicted 1368
7 SASI_Hs02_00325717 predicted 1191
8 SASI_Hs02_00325718 predicted 1236
9 SASI_Hs02_00325719 predicted 1255
10 SASI_Hs02_00325720 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325721 predicted 773
2 SASI_Hs02_00325722 predicted 583
3 SASI_Hs02_00325723 predicted 2340
4 SASI_Hs02_00325724 predicted 1763
5 SASI_Hs02_00325725 predicted 1218
6 SASI_Hs02_00325726 predicted 1322
7 SASI_Hs02_00325727 predicted 1140
8 SASI_Hs02_00325728 predicted 1192
9 SASI_Hs02_00325729 predicted 1202
10 SASI_Hs02_00325730 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067874 predicted 786
2 SASI_Hs02_00331762 predicted 595
3 SASI_Hs02_00331763 predicted 2351
4 SASI_Hs02_00331764 predicted 1771
5 SASI_Hs02_00331765 predicted 1223
6 SASI_Hs02_00331766 predicted 1332
7 SASI_Hs01_00067879 predicted 1151
8 SASI_Hs01_00067880 predicted 1197
9 SASI_Hs01_00067881 predicted 1211
10 SASI_Hs01_00067882 predicted 661
11 SASI_Hs01_00067875 predicted 970
12 SASI_Hs01_00067876 predicted 1789
13 SASI_Hs01_00067877 predicted 1104
14 SASI_Hs01_00067878 predicted 1037
15 SASI_Hs01_00067883 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071839 predicted 1264
2 SASI_Rn01_00071842 predicted 1709
3 SASI_Rn02_00266275 predicted 486
4 SASI_Rn01_00071843 predicted 1222
5 SASI_Rn02_00266276 predicted 1671
6 SASI_Rn02_00266277 predicted 1595
7 SASI_Rn01_00071845 predicted 1847
8 SASI_Rn02_00266278 predicted 1163
9 SASI_Rn01_00071846 predicted 282
10 SASI_Rn01_00071847 predicted 1130
11 SASI_Rn01_00071840 predicted 763
12 SASI_Rn01_00071841 predicted 1439
13 SASI_Rn01_00071844 predicted 1093
14 SASI_Rn01_00071848 predicted 2323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184433 predicted 829
2 SASI_Mm01_00184434 predicted 1152
3 SASI_Mm01_00184435 predicted 1561
4 SASI_Mm01_00184436 predicted 591
5 SASI_Mm01_00184438 predicted 392
6 SASI_Mm01_00184439 predicted 1223
7 SASI_Mm01_00184440 predicted 1778
8 SASI_Mm01_00184441 predicted 1571
9 SASI_Mm02_00351436 predicted 1374
10 SASI_Mm02_00351437 predicted 1815
11 SASI_Mm01_00184437 predicted 851
12 SASI_Mm01_00184442 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199307
VALIDATED
ECE1 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-1153s1c1
Sequence:CCGGGCCATCAACTGGTTACCCTTTCTCGAGAAAGGGTAACCAGTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199307.1-2229s1c1
Sequence:CCGGCCAGCTCTTCTTCCTAGGATTCTCGAGAATCCTAGGAAGAAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-2358s1c1
Sequence:CCGGCAAGGAGTTCTCAGAACACTTCTCGAGAAGTGTTCTGAGAACTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-951s1c1
Sequence:CCGGCCTGACTGGATACCTGAACTACTCGAGTAGTTCAGGTATCCAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-1778s1c1
Sequence:CCGGCCAACAGAGATCAGTGGAGTACTCGAGTACTCCACTGATCTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-1322s21c1
Sequence:CCGGTCATCAACAACACCGACAAATCTCGAGATTTGTCGGTGTTGTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-964s21c1
Sequence:CCGGTTGCCCTCCAGAGACTATTACCTCGAGGTAATAGTCTCTGGAGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-2418s21c1
Sequence:CCGGCAAGGAGTTCTCAGAACACTTCTCGAGAAGTGTTCTGAGAACTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-1011s21c1
Sequence:CCGGCCTGACTGGATACCTGAACTACTCGAGTAGTTCAGGTATCCAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199307
VALIDATED
ECE1 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-1153s1c1
Sequence:CCGGGCCATCAACTGGTTACCCTTTCTCGAGAAAGGGTAACCAGTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199307.1-2229s1c1
Sequence:CCGGCCAGCTCTTCTTCCTAGGATTCTCGAGAATCCTAGGAAGAAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-2358s1c1
Sequence:CCGGCAAGGAGTTCTCAGAACACTTCTCGAGAAGTGTTCTGAGAACTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-951s1c1
Sequence:CCGGCCTGACTGGATACCTGAACTACTCGAGTAGTTCAGGTATCCAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-1778s1c1
Sequence:CCGGCCAACAGAGATCAGTGGAGTACTCGAGTACTCCACTGATCTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-1322s21c1
Sequence:CCGGTCATCAACAACACCGACAAATCTCGAGATTTGTCGGTGTTGTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-964s21c1
Sequence:CCGGTTGCCCTCCAGAGACTATTACCTCGAGGTAATAGTCTCTGGAGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-2418s21c1
Sequence:CCGGCAAGGAGTTCTCAGAACACTTCTCGAGAAGTGTTCTGAGAACTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-1011s21c1
Sequence:CCGGCCTGACTGGATACCTGAACTACTCGAGTAGTTCAGGTATCCAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199307
VALIDATED
ECE1 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-1153s1c1
Sequence:CCGGGCCATCAACTGGTTACCCTTTCTCGAGAAAGGGTAACCAGTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199307.1-2229s1c1
Sequence:CCGGCCAGCTCTTCTTCCTAGGATTCTCGAGAATCCTAGGAAGAAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-2358s1c1
Sequence:CCGGCAAGGAGTTCTCAGAACACTTCTCGAGAAGTGTTCTGAGAACTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-951s1c1
Sequence:CCGGCCTGACTGGATACCTGAACTACTCGAGTAGTTCAGGTATCCAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_199307.1-1778s1c1
Sequence:CCGGCCAACAGAGATCAGTGGAGTACTCGAGTACTCCACTGATCTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-1322s21c1
Sequence:CCGGTCATCAACAACACCGACAAATCTCGAGATTTGTCGGTGTTGTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-964s21c1
Sequence:CCGGTTGCCCTCCAGAGACTATTACCTCGAGGTAATAGTCTCTGGAGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-2418s21c1
Sequence:CCGGCAAGGAGTTCTCAGAACACTTCTCGAGAAGTGTTCTGAGAACTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199307.2-1011s21c1
Sequence:CCGGCCTGACTGGATACCTGAACTACTCGAGTAGTTCAGGTATCCAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001397
VALIDATED
ECE1 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001397.1-1573s1c1
Sequence:CCGGGCAGTTCCAGACCTCTACTTTCTCGAGAAAGTAGAGGTCTGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001397.1-1237s1c1
Sequence:CCGGGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-1783s1c1
Sequence:CCGGGCCTTAAACTTTGGTGGCATACTCGAGTATGCCACCAAAGTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-1080s1c1
Sequence:CCGGGATCAATGAATCCGAGCCTATCTCGAGATAGGCTCGGATTCATTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-2226s1c1
Sequence:CCGGCCTCTCCAATTCCAAGGAGTTCTCGAGAACTCCTTGGAATTGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001397.2-2535s21c1
Sequence:CCGGTGGTGTTGGCTCTCAACGTGACTCGAGTCACGTTGAGAGCCAACACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-1471s21c1
Sequence:CCGGGAGATCATCCTGGAGATTAAGCTCGAGCTTAATCTCCAGGATGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-789s21c1
Sequence:CCGGTGTCTATGTCAGTGCCGATTCCTCGAGGAATCGGCACTGACATAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-1778s21c1
Sequence:CCGGACTACTCGCCCACCAAGAATGCTCGAGCATTCTTGGTGGGCGAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001397
VALIDATED
ECE1 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001397.1-1573s1c1
Sequence:CCGGGCAGTTCCAGACCTCTACTTTCTCGAGAAAGTAGAGGTCTGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001397.1-1237s1c1
Sequence:CCGGGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-1783s1c1
Sequence:CCGGGCCTTAAACTTTGGTGGCATACTCGAGTATGCCACCAAAGTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-1080s1c1
Sequence:CCGGGATCAATGAATCCGAGCCTATCTCGAGATAGGCTCGGATTCATTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-2226s1c1
Sequence:CCGGCCTCTCCAATTCCAAGGAGTTCTCGAGAACTCCTTGGAATTGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001397.2-2535s21c1
Sequence:CCGGTGGTGTTGGCTCTCAACGTGACTCGAGTCACGTTGAGAGCCAACACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-1471s21c1
Sequence:CCGGGAGATCATCCTGGAGATTAAGCTCGAGCTTAATCTCCAGGATGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-789s21c1
Sequence:CCGGTGTCTATGTCAGTGCCGATTCCTCGAGGAATCGGCACTGACATAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-1778s21c1
Sequence:CCGGACTACTCGCCCACCAAGAATGCTCGAGCATTCTTGGTGGGCGAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001397
VALIDATED
ECE1 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001397.1-1573s1c1
Sequence:CCGGGCAGTTCCAGACCTCTACTTTCTCGAGAAAGTAGAGGTCTGGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001397.1-1237s1c1
Sequence:CCGGGCCGATGAGAAGTTCATGGAACTCGAGTTCCATGAACTTCTCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-1783s1c1
Sequence:CCGGGCCTTAAACTTTGGTGGCATACTCGAGTATGCCACCAAAGTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-1080s1c1
Sequence:CCGGGATCAATGAATCCGAGCCTATCTCGAGATAGGCTCGGATTCATTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001397.1-2226s1c1
Sequence:CCGGCCTCTCCAATTCCAAGGAGTTCTCGAGAACTCCTTGGAATTGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001397.2-2535s21c1
Sequence:CCGGTGGTGTTGGCTCTCAACGTGACTCGAGTCACGTTGAGAGCCAACACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-1471s21c1
Sequence:CCGGGAGATCATCCTGGAGATTAAGCTCGAGCTTAATCTCCAGGATGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-789s21c1
Sequence:CCGGTGTCTATGTCAGTGCCGATTCCTCGAGGAATCGGCACTGACATAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001397.2-1778s21c1
Sequence:CCGGACTACTCGCCCACCAAGAATGCTCGAGCATTCTTGGTGGGCGAGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)