EMAIL THIS PAGE TO A FRIEND

ECE2

endothelin converting enzyme 2

Gene ID:
Human(9718) Summary: Endothelin-converting enzymes, such as ECE2 (EC 3.4.24.71), are type II metalloproteases that generate functionally pleiotropic members of the endothelin vasoactive peptide family (Lorenzo et al., 2001 [PubMed 11718899]
Mouse(107522) endothelin converting enzyme 2
Rat(408243) endothelin-converting enzyme 2
chicken(100857430) endothelin converting enzyme 2
domestic cat(101086921) endothelin converting enzyme 2
cow(281134) endothelin converting enzyme 2
Horse(100059042) endothelin converting enzyme 2
dog(488105) endothelin converting enzyme 2
sheep(101121054) endothelin converting enzyme 2
Domestic Rabbit(100348333) endothelin converting enzyme 2
domestic guinea pig(100725061) endothelin converting enzyme 2
naked mole-rat(101712068) endothelin converting enzyme 2
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037324 Rosetta Predictions human pricing
NM_001100120 Rosetta Predictions human pricing
NM_001100121 Rosetta Predictions human pricing
NM_014693 Rosetta Predictions human pricing
NM_032331 Rosetta Predictions human pricing
NM_001002815 Rosetta Predictions rat pricing
NM_025462 Rosetta Predictions mouse pricing
NM_139293 Rosetta Predictions mouse pricing
NM_177940 Rosetta Predictions mouse pricing
NM_177941 Rosetta Predictions mouse pricing
NM_177942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052438 predicted 834
2 SASI_Hs01_00052439 predicted 1194
3 SASI_Hs01_00052440 predicted 650
4 SASI_Hs01_00052441 predicted 539
5 SASI_Hs01_00052442 predicted 1554
6 SASI_Hs01_00052443 predicted 1828
7 SASI_Hs01_00052444 predicted 514
8 SASI_Hs01_00052445 predicted 1750
9 SASI_Hs01_00052446 predicted 845
10 SASI_Hs01_00052447 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321694 predicted 1055
2 SASI_Hs02_00321695 predicted 1418
3 SASI_Hs02_00321696 predicted 875
4 SASI_Hs02_00321697 predicted 766
5 SASI_Hs02_00321698 predicted 1783
6 SASI_Hs02_00321699 predicted 2051
7 SASI_Hs02_00321700 predicted 737
8 SASI_Hs02_00321701 predicted 1978
9 SASI_Hs02_00321702 predicted 1076
10 SASI_Hs02_00321703 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321704 predicted 923
2 SASI_Hs02_00321705 predicted 1283
3 SASI_Hs02_00321706 predicted 738
4 SASI_Hs02_00321707 predicted 629
5 SASI_Hs02_00321708 predicted 1640
6 SASI_Hs02_00321709 predicted 1912
7 SASI_Hs02_00321710 predicted 592
8 SASI_Hs02_00321711 predicted 1837
9 SASI_Hs02_00321712 predicted 932
10 SASI_Hs02_00321713 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200433 predicted 1168
2 SASI_Hs01_00200434 predicted 1531
3 SASI_Hs01_00200435 predicted 989
4 SASI_Hs01_00200436 predicted 875
5 SASI_Hs01_00200437 predicted 1893
6 SASI_Hs01_00200438 predicted 2161
7 SASI_Hs01_00200439 predicted 842
8 SASI_Hs01_00200440 predicted 2090
9 SASI_Hs01_00200441 predicted 1181
10 SASI_Hs01_00200442 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030200 predicted 289
2 SASI_Hs02_00359702 predicted 202
3 SASI_Hs01_00030201 predicted 223
4 SASI_Hs02_00359703 predicted 215
5 SASI_Hs02_00359704 predicted 281
6 SASI_Hs02_00359705 predicted 209
7 SASI_Hs02_00359706 predicted 203
8 SASI_Hs02_00359707 predicted 209
9 SASI_Hs02_00359708 predicted 280
10 SASI_Hs02_00359709 predicted 201
11 SASI_Hs01_00030199 predicted 735
12 SASI_Hs01_00030202 predicted 604
13 SASI_Hs01_00030203 predicted 485
14 SASI_Hs01_00030204 predicted 634
15 SASI_Hs01_00030205 predicted 628
16 SASI_Hs01_00030206 predicted 276
17 SASI_Hs01_00030207 predicted 538
18 SASI_Hs01_00030208 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061773 predicted 958
2 SASI_Rn01_00061774 predicted 1142
3 SASI_Rn01_00061775 predicted 478
4 SASI_Rn01_00061776 predicted 1082
5 SASI_Rn01_00061777 predicted 1591
6 SASI_Rn01_00061778 predicted 1463
7 SASI_Rn01_00061780 predicted 1832
8 SASI_Rn01_00061782 predicted 1297
9 SASI_Rn02_00198000 predicted 1820
10 SASI_Rn02_00198001 predicted 706
11 SASI_Rn01_00061779 predicted 1083
12 SASI_Rn01_00061781 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328301 predicted 210
2 SASI_Mm02_00328302 predicted 280
3 SASI_Mm02_00328303 predicted 222
4 SASI_Mm02_00328304 predicted 216
5 SASI_Mm02_00328305 predicted 205
6 SASI_Mm02_00328306 predicted 211
7 SASI_Mm02_00328307 predicted 263
8 SASI_Mm02_00328308 predicted 270
9 SASI_Mm02_00328309 predicted 262
10 SASI_Mm02_00328310 predicted 203
11 SASI_Mm01_00191842 predicted 559
12 SASI_Mm01_00191843 predicted 444
13 SASI_Mm01_00191844 predicted 906
14 SASI_Mm01_00191845 predicted 837
15 SASI_Mm01_00191846 predicted 454
16 SASI_Mm01_00191847 predicted 359
17 SASI_Mm01_00191848 predicted 774
18 SASI_Mm01_00191849 predicted 330
19 SASI_Mm01_00191850 predicted 450
20 SASI_Mm01_00191851 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058537 predicted 1233
2 SASI_Mm01_00058538 predicted 858
3 SASI_Mm01_00058539 predicted 1286
4 SASI_Mm01_00058540 predicted 2507
5 SASI_Mm01_00058541 predicted 1740
6 SASI_Mm02_00339969 predicted 1232
7 SASI_Mm01_00058543 predicted 2375
8 SASI_Mm01_00058544 predicted 2151
9 SASI_Mm01_00058546 predicted 2490
10 SASI_Mm02_00339970 predicted 2524
11 SASI_Mm01_00058542 predicted 1560
12 SASI_Mm01_00058545 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348415 predicted 1457
2 SASI_Mm02_00348416 predicted 1083
3 SASI_Mm02_00348417 predicted 1505
4 SASI_Mm02_00348418 predicted 2724
5 SASI_Mm02_00348419 predicted 1963
6 SASI_Mm02_00348420 predicted 1457
7 SASI_Mm02_00348421 predicted 2593
8 SASI_Mm02_00348422 predicted 2375
9 SASI_Mm02_00348423 predicted 2711
10 SASI_Mm02_00348424 predicted 2742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348425 predicted 1543
2 SASI_Mm02_00348426 predicted 1169
3 SASI_Mm02_00348427 predicted 1590
4 SASI_Mm02_00348428 predicted 2813
5 SASI_Mm02_00348429 predicted 2051
6 SASI_Mm02_00348430 predicted 1547
7 SASI_Mm02_00348431 predicted 2680
8 SASI_Mm02_00348432 predicted 2455
9 SASI_Mm02_00348433 predicted 2801
10 SASI_Mm02_00348434 predicted 2830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348435 predicted 1148
2 SASI_Mm02_00348436 predicted 773
3 SASI_Mm02_00348437 predicted 1196
4 SASI_Mm02_00348438 predicted 2423
5 SASI_Mm02_00348439 predicted 1654
6 SASI_Mm02_00348440 predicted 1151
7 SASI_Mm02_00348441 predicted 2287
8 SASI_Mm02_00348442 predicted 2063
9 SASI_Mm02_00348443 predicted 2405
10 SASI_Mm02_00348444 predicted 2440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014693
ECE2 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014693.2-3250s1c1
Sequence:CCGGGCACAAGCCTTAGCAAATGATCTCGAGATCATTTGCTAAGGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-2012s1c1
Sequence:CCGGCCTTCCAACTAAGAATGAGATCTCGAGATCTCATTCTTAGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-2334s1c1
Sequence:CCGGGCTGCCTACAATGCTTACAAACTCGAGTTTGTAAGCATTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-1801s1c1
Sequence:CCGGCCATCTATGATATGATTGGTTCTCGAGAACCAATCATATCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-1096s1c1
Sequence:CCGGCCTCTCGGGATTACTACTTAACTCGAGTTAAGTAGTAATCCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014693
ECE2 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014693.2-3250s1c1
Sequence:CCGGGCACAAGCCTTAGCAAATGATCTCGAGATCATTTGCTAAGGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-2012s1c1
Sequence:CCGGCCTTCCAACTAAGAATGAGATCTCGAGATCTCATTCTTAGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-2334s1c1
Sequence:CCGGGCTGCCTACAATGCTTACAAACTCGAGTTTGTAAGCATTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-1801s1c1
Sequence:CCGGCCATCTATGATATGATTGGTTCTCGAGAACCAATCATATCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-1096s1c1
Sequence:CCGGCCTCTCGGGATTACTACTTAACTCGAGTTAAGTAGTAATCCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014693
ECE2 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014693.2-3250s1c1
Sequence:CCGGGCACAAGCCTTAGCAAATGATCTCGAGATCATTTGCTAAGGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-2012s1c1
Sequence:CCGGCCTTCCAACTAAGAATGAGATCTCGAGATCTCATTCTTAGTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-2334s1c1
Sequence:CCGGGCTGCCTACAATGCTTACAAACTCGAGTTTGTAAGCATTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-1801s1c1
Sequence:CCGGCCATCTATGATATGATTGGTTCTCGAGAACCAATCATATCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014693.2-1096s1c1
Sequence:CCGGCCTCTCGGGATTACTACTTAACTCGAGTTAAGTAGTAATCCCGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139293
VALIDATED
ECE2 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139293.1-2575s1c1
Sequence:CCGGCCATTCACTGTGACATCCTTTCTCGAGAAAGGATGTCACAGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139293.1-2107s1c1
Sequence:CCGGGCTGCTTACAATGCTTACAAACTCGAGTTTGTAAGCATTGTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139293.1-550s1c1
Sequence:CCGGGCCATACTGAAGCACCTACTTCTCGAGAAGTAGGTGCTTCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139293.1-1570s1c1
Sequence:CCGGGATGCCATCTATGATATGATTCTCGAGAATCATATCATAGATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139293.1-1896s1c1
Sequence:CCGGCCATGAGTTGACACATGCCTTCTCGAGAAGGCATGTGTCAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139293
VALIDATED
ECE2 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139293.1-2575s1c1
Sequence:CCGGCCATTCACTGTGACATCCTTTCTCGAGAAAGGATGTCACAGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139293.1-2107s1c1
Sequence:CCGGGCTGCTTACAATGCTTACAAACTCGAGTTTGTAAGCATTGTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139293.1-550s1c1
Sequence:CCGGGCCATACTGAAGCACCTACTTCTCGAGAAGTAGGTGCTTCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139293.1-1570s1c1
Sequence:CCGGGATGCCATCTATGATATGATTCTCGAGAATCATATCATAGATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139293.1-1896s1c1
Sequence:CCGGCCATGAGTTGACACATGCCTTCTCGAGAAGGCATGTGTCAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139293
VALIDATED
ECE2 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139293.1-2575s1c1
Sequence:CCGGCCATTCACTGTGACATCCTTTCTCGAGAAAGGATGTCACAGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139293.1-2107s1c1
Sequence:CCGGGCTGCTTACAATGCTTACAAACTCGAGTTTGTAAGCATTGTAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139293.1-550s1c1
Sequence:CCGGGCCATACTGAAGCACCTACTTCTCGAGAAGTAGGTGCTTCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139293.1-1570s1c1
Sequence:CCGGGATGCCATCTATGATATGATTCTCGAGAATCATATCATAGATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139293.1-1896s1c1
Sequence:CCGGCCATGAGTTGACACATGCCTTCTCGAGAAGGCATGTGTCAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032331
ECE2 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-778s1c1
Sequence:CCGGCTTCCTTAGTGCCATTCAGCTCTCGAGAGCTGAATGGCACTAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-540s1c1
Sequence:CCGGGCCGGTTTATCTCAATGACTTCTCGAGAAGTCATTGAGATAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-541s1c1
Sequence:CCGGCCGGTTTATCTCAATGACTTCCTCGAGGAAGTCATTGAGATAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-640s1c1
Sequence:CCGGCGGTTTCCACTTCCATCTCTACTCGAGTAGAGATGGAAGTGGAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-646s1c1
Sequence:CCGGCCACTTCCATCTCTACCTCATCTCGAGATGAGGTAGAGATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-773s1c1
Sequence:CCGGGAGGACTTCCTTAGTGCCATTCTCGAGAATGGCACTAAGGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-652s1c1
Sequence:CCGGCCATCTCTACCTCATGCACAACTCGAGTTGTGCATGAGGTAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-274s1c1
Sequence:CCGGCTTCCCTAATGTGACCAGTGTCTCGAGACACTGGTCACATTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032331
ECE2 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-778s1c1
Sequence:CCGGCTTCCTTAGTGCCATTCAGCTCTCGAGAGCTGAATGGCACTAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-540s1c1
Sequence:CCGGGCCGGTTTATCTCAATGACTTCTCGAGAAGTCATTGAGATAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-541s1c1
Sequence:CCGGCCGGTTTATCTCAATGACTTCCTCGAGGAAGTCATTGAGATAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-640s1c1
Sequence:CCGGCGGTTTCCACTTCCATCTCTACTCGAGTAGAGATGGAAGTGGAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-646s1c1
Sequence:CCGGCCACTTCCATCTCTACCTCATCTCGAGATGAGGTAGAGATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-773s1c1
Sequence:CCGGGAGGACTTCCTTAGTGCCATTCTCGAGAATGGCACTAAGGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-652s1c1
Sequence:CCGGCCATCTCTACCTCATGCACAACTCGAGTTGTGCATGAGGTAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-274s1c1
Sequence:CCGGCTTCCCTAATGTGACCAGTGTCTCGAGACACTGGTCACATTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032331
ECE2 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-778s1c1
Sequence:CCGGCTTCCTTAGTGCCATTCAGCTCTCGAGAGCTGAATGGCACTAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-540s1c1
Sequence:CCGGGCCGGTTTATCTCAATGACTTCTCGAGAAGTCATTGAGATAAACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-541s1c1
Sequence:CCGGCCGGTTTATCTCAATGACTTCCTCGAGGAAGTCATTGAGATAAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-640s1c1
Sequence:CCGGCGGTTTCCACTTCCATCTCTACTCGAGTAGAGATGGAAGTGGAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-646s1c1
Sequence:CCGGCCACTTCCATCTCTACCTCATCTCGAGATGAGGTAGAGATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032331.2-773s1c1
Sequence:CCGGGAGGACTTCCTTAGTGCCATTCTCGAGAATGGCACTAAGGAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-652s1c1
Sequence:CCGGCCATCTCTACCTCATGCACAACTCGAGTTGTGCATGAGGTAGAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032331.2-274s1c1
Sequence:CCGGCTTCCCTAATGTGACCAGTGTCTCGAGACACTGGTCACATTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025462
ECE2 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025462.1-827s1c1
Sequence:CCGGCCTTTGTGCATTAGGCTCCTACTCGAGTAGGAGCCTAATGCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-309s1c1
Sequence:CCGGGCAGCCATGCAAGTTCGCTATCTCGAGATAGCGAACTTGCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-579s1c1
Sequence:CCGGCACTATGCTCAATCCCGTTATCTCGAGATAACGGGATTGAGCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-282s1c1
Sequence:CCGGAGTGTGGATTACTCTCCAGTACTCGAGTACTGGAGAGTAATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-577s1c1
Sequence:CCGGGACACTATGCTCAATCCCGTTCTCGAGAACGGGATTGAGCATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025462
ECE2 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025462.1-827s1c1
Sequence:CCGGCCTTTGTGCATTAGGCTCCTACTCGAGTAGGAGCCTAATGCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-309s1c1
Sequence:CCGGGCAGCCATGCAAGTTCGCTATCTCGAGATAGCGAACTTGCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-579s1c1
Sequence:CCGGCACTATGCTCAATCCCGTTATCTCGAGATAACGGGATTGAGCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-282s1c1
Sequence:CCGGAGTGTGGATTACTCTCCAGTACTCGAGTACTGGAGAGTAATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-577s1c1
Sequence:CCGGGACACTATGCTCAATCCCGTTCTCGAGAACGGGATTGAGCATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025462
ECE2 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025462.1-827s1c1
Sequence:CCGGCCTTTGTGCATTAGGCTCCTACTCGAGTAGGAGCCTAATGCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-309s1c1
Sequence:CCGGGCAGCCATGCAAGTTCGCTATCTCGAGATAGCGAACTTGCATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-579s1c1
Sequence:CCGGCACTATGCTCAATCCCGTTATCTCGAGATAACGGGATTGAGCATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-282s1c1
Sequence:CCGGAGTGTGGATTACTCTCCAGTACTCGAGTACTGGAGAGTAATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025462.1-577s1c1
Sequence:CCGGGACACTATGCTCAATCCCGTTCTCGAGAACGGGATTGAGCATAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks