EMAIL THIS PAGE TO A FRIEND

ECEL1

endothelin converting enzyme-like 1

52 Gene Product Result for
Synonyms: DA5D DINE ECEX XCE
UniProtKB ID: O95672, Q45UD9, Q53RF9, Q6UW86, Q86TH4, Q9NY95
Gene ID:
Human(9427) Summary: This gene encodes a member of the M13 family of endopeptidases. In general, M13 family members are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. This gene is expressed specifically in the central nervous system and its protein localizes predominately to the endoplasmic reticulum or, in trace amounts, to the cell surface. Disruption of this gene in mouse embryonic stem cells results in neonatal lethality due to respiratory failure shortly after birth. Based on the specific expression of this gene and the phenotype of the gene deficiency in mouse embryos, it is suggested that this protein plays a critical role in neural regulation of the respiratory system. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
Mouse(13599) endothelin converting enzyme-like 1
Rat(60417) endothelin converting enzyme-like 1
naked mole-rat(101705383) endothelin converting enzyme-like 1
domestic guinea pig(100734087) endothelin converting enzyme-like 1
sheep(101102212) endothelin converting enzyme-like 1
chicken(424937) endothelin converting enzyme-like 1
dog(486161) endothelin converting enzyme-like 1
cow(513144) endothelin converting enzyme-like 1
domestic cat(101084132) endothelin converting enzyme-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
B5181 7-Methoxycoumarin-4-acetyl [Ala7-(2,4-Dinitrophenyl)Lys9]-Bradykinin trifluoroacetate salt >94% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004826 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137161 MISSION® esiRNA esiRNA human ECEL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004826 Rosetta Predictions human pricing
NM_021776 Rosetta Predictions rat pricing
NM_021306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338392 predicted 2319
2 SASI_Hs01_00085573 predicted 1775
3 SASI_Hs01_00085575 predicted 1073
4 SASI_Hs01_00085576 predicted 1262
5 SASI_Hs02_00338393 predicted 1915
6 SASI_Hs01_00085579 predicted 2148
7 SASI_Hs02_00338394 predicted 1184
8 SASI_Hs02_00338395 predicted 1170
9 SASI_Hs01_00085582 predicted 1185
10 SASI_Hs01_00085580 predicted 2307
11 SASI_Hs01_00085574 predicted 1179
12 SASI_Hs01_00085577 predicted 1023
13 SASI_Hs01_00085578 predicted 1201
14 SASI_Hs01_00085581 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073682 predicted 1821
2 SASI_Rn01_00073683 predicted 1057
3 SASI_Rn01_00073684 predicted 2495
4 SASI_Rn01_00073685 predicted 1678
5 SASI_Rn01_00073686 predicted 964
6 SASI_Rn01_00073687 predicted 2393
7 SASI_Rn01_00073689 predicted 2148
8 SASI_Rn01_00073690 predicted 1491
9 SASI_Rn01_00073691 predicted 792
10 SASI_Rn02_00262834 predicted 1523
11 SASI_Rn01_00073688 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121701 predicted 1673
2 SASI_Mm01_00121702 predicted 2445
3 SASI_Mm01_00121703 predicted 994
4 SASI_Mm01_00121704 predicted 1743
5 SASI_Mm01_00121705 predicted 1759
6 SASI_Mm02_00325851 predicted 1898
7 SASI_Mm01_00121707 predicted 1209
8 SASI_Mm01_00121708 predicted 1171
9 SASI_Mm01_00121709 predicted 2003
10 SASI_Mm01_00121710 predicted 1429
11 SASI_Mm01_00121706 predicted 1311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021306
ECEL1 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021306.2-2463s1c1
Sequence:CCGGCGGGTCTATCTTCCTTCCCAACTCGAGTTGGGAAGGAAGATAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-75s1c1
Sequence:CCGGGAGTTCCAGGAAGTCAAGTATCTCGAGATACTTGACTTCCTGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-1000s1c1
Sequence:CCGGCCAATATCTCTGTGTCAGAATCTCGAGATTCTGACACAGAGATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-2279s1c1
Sequence:CCGGCGTATCCCAGTTTGAGGAATTCTCGAGAATTCCTCAAACTGGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-1664s1c1
Sequence:CCGGCATCCGATTCAGTATCCAGTTCTCGAGAACTGGATACTGAATCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021306
ECEL1 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021306.2-2463s1c1
Sequence:CCGGCGGGTCTATCTTCCTTCCCAACTCGAGTTGGGAAGGAAGATAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-75s1c1
Sequence:CCGGGAGTTCCAGGAAGTCAAGTATCTCGAGATACTTGACTTCCTGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-1000s1c1
Sequence:CCGGCCAATATCTCTGTGTCAGAATCTCGAGATTCTGACACAGAGATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-2279s1c1
Sequence:CCGGCGTATCCCAGTTTGAGGAATTCTCGAGAATTCCTCAAACTGGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-1664s1c1
Sequence:CCGGCATCCGATTCAGTATCCAGTTCTCGAGAACTGGATACTGAATCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021306
ECEL1 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021306.2-2463s1c1
Sequence:CCGGCGGGTCTATCTTCCTTCCCAACTCGAGTTGGGAAGGAAGATAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-75s1c1
Sequence:CCGGGAGTTCCAGGAAGTCAAGTATCTCGAGATACTTGACTTCCTGGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-1000s1c1
Sequence:CCGGCCAATATCTCTGTGTCAGAATCTCGAGATTCTGACACAGAGATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-2279s1c1
Sequence:CCGGCGTATCCCAGTTTGAGGAATTCTCGAGAATTCCTCAAACTGGGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021306.2-1664s1c1
Sequence:CCGGCATCCGATTCAGTATCCAGTTCTCGAGAACTGGATACTGAATCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004826
ECEL1 MISSION shRNA Bacterial Glycerol Stock
endothelin converting enzyme-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-2155s1c1
Sequence:CCGGCGTCCGTCTCTATGACAACTTCTCGAGAAGTTGTCATAGAGACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1910s1c1
Sequence:CCGGGCGCTCAATGCCTACTATCTACTCGAGTAGATAGTAGGCATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1178s1c1
Sequence:CCGGGTGTCAGAGTATGACGACCTACTCGAGTAGGTCGTCATACTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-626s1c1
Sequence:CCGGCCCGACGACAAGCTCACCTATCTCGAGATAGGTGAGCTTGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1795s1c1
Sequence:CCGGCCATGAGAAGACCTACTTCAACTCGAGTTGAAGTAGGTCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004826.2-1057s21c1
Sequence:CCGGGAAGATCCTGGCAGCATACAGCTCGAGCTGTATGCTGCCAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004826.2-1621s21c1
Sequence:CCGGGCTAGTGGAAGACATCAAGTACTCGAGTACTTGATGTCTTCCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004826
ECEL1 MISSION shRNA shRNA Plasmid DNA
endothelin converting enzyme-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-2155s1c1
Sequence:CCGGCGTCCGTCTCTATGACAACTTCTCGAGAAGTTGTCATAGAGACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1910s1c1
Sequence:CCGGGCGCTCAATGCCTACTATCTACTCGAGTAGATAGTAGGCATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1178s1c1
Sequence:CCGGGTGTCAGAGTATGACGACCTACTCGAGTAGGTCGTCATACTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-626s1c1
Sequence:CCGGCCCGACGACAAGCTCACCTATCTCGAGATAGGTGAGCTTGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1795s1c1
Sequence:CCGGCCATGAGAAGACCTACTTCAACTCGAGTTGAAGTAGGTCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004826.2-1057s21c1
Sequence:CCGGGAAGATCCTGGCAGCATACAGCTCGAGCTGTATGCTGCCAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004826.2-1621s21c1
Sequence:CCGGGCTAGTGGAAGACATCAAGTACTCGAGTACTTGATGTCTTCCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004826
ECEL1 MISSION shRNA Lentiviral Transduction Particles
endothelin converting enzyme-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-2155s1c1
Sequence:CCGGCGTCCGTCTCTATGACAACTTCTCGAGAAGTTGTCATAGAGACGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1910s1c1
Sequence:CCGGGCGCTCAATGCCTACTATCTACTCGAGTAGATAGTAGGCATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1178s1c1
Sequence:CCGGGTGTCAGAGTATGACGACCTACTCGAGTAGGTCGTCATACTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-626s1c1
Sequence:CCGGCCCGACGACAAGCTCACCTATCTCGAGATAGGTGAGCTTGTCGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004826.1-1795s1c1
Sequence:CCGGCCATGAGAAGACCTACTTCAACTCGAGTTGAAGTAGGTCTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004826.2-1057s21c1
Sequence:CCGGGAAGATCCTGGCAGCATACAGCTCGAGCTGTATGCTGCCAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004826.2-1621s21c1
Sequence:CCGGGCTAGTGGAAGACATCAAGTACTCGAGTACTTGATGTCTTCCACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks