EMAIL THIS PAGE TO A FRIEND

ECH1

enoyl CoA hydratase 1, peroxisomal

56 Gene Product Result for
Synonyms: HPXEL
UniProtKB ID: Q13011, A8K745, Q8WVX0, Q96EZ9
Gene ID:
Human(1891) Summary: This gene encodes a member of the hydratase/isomerase superfamily. The gene product shows high sequence similarity to enoyl-coenzyme A (CoA) hydratases of several species, particularly within a conserved domain characteristic of these proteins. The encoded protein, which contains a C-terminal peroxisomal targeting sequence, localizes to the peroxisome. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans,5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. This enzyme functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators. [provided by RefSeq, Jul 2008]
Mouse(51798) enoyl coenzyme A hydratase 1, peroxisomal
Rat(64526) enoyl CoA hydratase 1, peroxisomal
Zebrafish(450048) enoyl CoA hydratase 1, peroxisomal
cow(507431) enoyl CoA hydratase 1, peroxisomal
domestic cat(101093730) enoyl CoA hydratase 1, peroxisomal
dog(476467) enoyl CoA hydratase 1, peroxisomal
chicken(100858352) enoyl CoA hydratase 1, peroxisomal
sheep(101112922) enoyl CoA hydratase 1, peroxisomal
domestic guinea pig(100729526) enoyl CoA hydratase 1, peroxisomal
naked mole-rat(101712915) enoyl CoA hydratase 1, peroxisomal
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001398 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001398 Rosetta Predictions human pricing
NM_022594 Rosetta Predictions rat pricing
NM_016772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205525 predicted 255
2 SASI_Hs02_00331767 predicted 833
3 SASI_Hs01_00205527 predicted 382
4 SASI_Hs01_00205528 predicted 479
5 SASI_Hs01_00205529 predicted 680
6 SASI_Hs01_00205531 predicted 265
7 SASI_Hs02_00331768 predicted 395
8 SASI_Hs01_00205532 predicted 340
9 SASI_Hs01_00205533 predicted 494
10 SASI_Hs01_00205534 predicted 756
11 SASI_Hs01_00205526 predicted 304
12 SASI_Hs01_00205530 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078849 predicted 747
2 SASI_Rn01_00078850 predicted 773
3 SASI_Rn01_00078851 predicted 338
4 SASI_Rn01_00078852 predicted 425
5 SASI_Rn01_00078853 predicted 784
6 SASI_Rn01_00078854 predicted 863
7 SASI_Rn01_00078855 predicted 553
8 SASI_Rn02_00263344 predicted 265
9 SASI_Rn01_00078856 predicted 397
10 SASI_Rn01_00078857 predicted 238
11 SASI_Rn01_00078858 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155043 predicted 543
2 SASI_Mm01_00155044 predicted 377
3 SASI_Mm01_00155045 predicted 774
4 SASI_Mm01_00155046 predicted 784
5 SASI_Mm01_00155047 predicted 870
6 SASI_Mm01_00155048 predicted 855
7 SASI_Mm01_00155049 predicted 459
8 SASI_Mm01_00155050 predicted 571
9 SASI_Mm01_00155051 predicted 800
10 SASI_Mm01_00155052 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016772
VALIDATED
ECH1 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase 1, peroxisomal
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016772.1-165s21c1
Sequence:CCGGGAAGTCTCAGACCACAACTATCTCGAGATAGTTGTGGTCTGAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-792s21c1
Sequence:CCGGTTTGCCCTGGCGGCTGATATTCTCGAGAATATCAGCCGCCAGGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-95s21c1
Sequence:CCGGGCTGTACTTCAACATCAGCCTCTCGAGAGGCTGATGTTGAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-599s1c1
Sequence:CCGGCCAGATCAAGGAGGTAGATATCTCGAGATATCTACCTCCTTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-254s21c1
Sequence:CCGGGAATGCCATGAACAGGGCTTTCTCGAGAAAGCCCTGTTCATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016772.1-600s21c1
Sequence:CCGGCAGATCAAGGAGGTAGATATGCTCGAGCATATCTACCTCCTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-165s1c1
Sequence:CCGGGAAGTCTCAGACCACAACTATCTCGAGATAGTTGTGGTCTGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016772.1-758s1c1
Sequence:CCGGGTTCCAAGATAAGGACGCCATCTCGAGATGGCGTCCTTATCTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-254s1c1
Sequence:CCGGGAATGCCATGAACAGGGCTTTCTCGAGAAAGCCCTGTTCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-95s1c1
Sequence:CCGGGCTGTACTTCAACATCAGCCTCTCGAGAGGCTGATGTTGAAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-352s1c1
Sequence:CCGGGAAAGATGTTCACTTCAGGTACTCGAGTACCTGAAGTGAACATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-932s1c1
Sequence:CCGGCCAGGACATCATCAAATCAGTCTCGAGACTGATTTGATGATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016772.1-172s1c1
Sequence:CCGGCAGACCACAACTATGAGTCTACTCGAGTAGACTCATAGTTGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016772
VALIDATED
ECH1 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase 1, peroxisomal
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016772.1-165s21c1
Sequence:CCGGGAAGTCTCAGACCACAACTATCTCGAGATAGTTGTGGTCTGAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-792s21c1
Sequence:CCGGTTTGCCCTGGCGGCTGATATTCTCGAGAATATCAGCCGCCAGGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-95s21c1
Sequence:CCGGGCTGTACTTCAACATCAGCCTCTCGAGAGGCTGATGTTGAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-599s1c1
Sequence:CCGGCCAGATCAAGGAGGTAGATATCTCGAGATATCTACCTCCTTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-254s21c1
Sequence:CCGGGAATGCCATGAACAGGGCTTTCTCGAGAAAGCCCTGTTCATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016772.1-600s21c1
Sequence:CCGGCAGATCAAGGAGGTAGATATGCTCGAGCATATCTACCTCCTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-165s1c1
Sequence:CCGGGAAGTCTCAGACCACAACTATCTCGAGATAGTTGTGGTCTGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016772.1-758s1c1
Sequence:CCGGGTTCCAAGATAAGGACGCCATCTCGAGATGGCGTCCTTATCTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-254s1c1
Sequence:CCGGGAATGCCATGAACAGGGCTTTCTCGAGAAAGCCCTGTTCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-95s1c1
Sequence:CCGGGCTGTACTTCAACATCAGCCTCTCGAGAGGCTGATGTTGAAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-352s1c1
Sequence:CCGGGAAAGATGTTCACTTCAGGTACTCGAGTACCTGAAGTGAACATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-932s1c1
Sequence:CCGGCCAGGACATCATCAAATCAGTCTCGAGACTGATTTGATGATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016772.1-172s1c1
Sequence:CCGGCAGACCACAACTATGAGTCTACTCGAGTAGACTCATAGTTGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016772
VALIDATED
ECH1 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase 1, peroxisomal
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016772.1-165s21c1
Sequence:CCGGGAAGTCTCAGACCACAACTATCTCGAGATAGTTGTGGTCTGAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-792s21c1
Sequence:CCGGTTTGCCCTGGCGGCTGATATTCTCGAGAATATCAGCCGCCAGGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-95s21c1
Sequence:CCGGGCTGTACTTCAACATCAGCCTCTCGAGAGGCTGATGTTGAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-599s1c1
Sequence:CCGGCCAGATCAAGGAGGTAGATATCTCGAGATATCTACCTCCTTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016772.1-254s21c1
Sequence:CCGGGAATGCCATGAACAGGGCTTTCTCGAGAAAGCCCTGTTCATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016772.1-600s21c1
Sequence:CCGGCAGATCAAGGAGGTAGATATGCTCGAGCATATCTACCTCCTTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-165s1c1
Sequence:CCGGGAAGTCTCAGACCACAACTATCTCGAGATAGTTGTGGTCTGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016772.1-758s1c1
Sequence:CCGGGTTCCAAGATAAGGACGCCATCTCGAGATGGCGTCCTTATCTTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-254s1c1
Sequence:CCGGGAATGCCATGAACAGGGCTTTCTCGAGAAAGCCCTGTTCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016772.1-95s1c1
Sequence:CCGGGCTGTACTTCAACATCAGCCTCTCGAGAGGCTGATGTTGAAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-352s1c1
Sequence:CCGGGAAAGATGTTCACTTCAGGTACTCGAGTACCTGAAGTGAACATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016772.1-932s1c1
Sequence:CCGGCCAGGACATCATCAAATCAGTCTCGAGACTGATTTGATGATGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016772.1-172s1c1
Sequence:CCGGCAGACCACAACTATGAGTCTACTCGAGTAGACTCATAGTTGTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001398
VALIDATED
ECH1 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase 1, peroxisomal
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001398.1-765s1c3
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-453s1c1
Sequence:CCGGCCGTGACATCATCACTCGATACTCGAGTATCGAGTGATGATGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-295s1c1
Sequence:CCGGGTAGAGTGCTTCAACAAGATTCTCGAGAATCTTGTTGAAGCACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-261s1c1
Sequence:CCGGGAATGCCATGAACAAGGTCTTCTCGAGAAGACCTTGTTCATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-960s1c1
Sequence:CCGGCCAGCCCACGACTGAGAACAACTCGAGTTGTTCTCAGTCGTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-765s1c1
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001398.1-765s1c2
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001398
VALIDATED
ECH1 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase 1, peroxisomal
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001398.1-765s1c3
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-453s1c1
Sequence:CCGGCCGTGACATCATCACTCGATACTCGAGTATCGAGTGATGATGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-295s1c1
Sequence:CCGGGTAGAGTGCTTCAACAAGATTCTCGAGAATCTTGTTGAAGCACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-261s1c1
Sequence:CCGGGAATGCCATGAACAAGGTCTTCTCGAGAAGACCTTGTTCATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-960s1c1
Sequence:CCGGCCAGCCCACGACTGAGAACAACTCGAGTTGTTCTCAGTCGTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-765s1c1
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001398.1-765s1c2
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001398
VALIDATED
ECH1 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase 1, peroxisomal
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001398.1-765s1c3
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-453s1c1
Sequence:CCGGCCGTGACATCATCACTCGATACTCGAGTATCGAGTGATGATGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-295s1c1
Sequence:CCGGGTAGAGTGCTTCAACAAGATTCTCGAGAATCTTGTTGAAGCACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-261s1c1
Sequence:CCGGGAATGCCATGAACAAGGTCTTCTCGAGAAGACCTTGTTCATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-960s1c1
Sequence:CCGGCCAGCCCACGACTGAGAACAACTCGAGTTGTTCTCAGTCGTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001398.1-765s1c1
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001398.1-765s1c2
Sequence:CCGGGTTCCCAGACAAAGAGGTCATCTCGAGATGACCTCTTTGTCTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks