EMAIL THIS PAGE TO A FRIEND

ECHDC1

enoyl CoA hydratase domain containing 1

113 Gene Product Result for
Synonyms: MMCD dJ351K20.2
Gene ID:
Mouse(52665) enoyl Coenzyme A hydratase domain containing 1
Rat(361465) enoyl CoA hydratase domain containing 1
Zebrafish(553585) enoyl Coenzyme A hydratase domain containing 1
dog(609850) enoyl CoA hydratase domain containing 1
chicken(769021) enoyl CoA hydratase domain containing 1
cow(536284) enoyl CoA hydratase domain containing 1
domestic cat(101086310) enoyl CoA hydratase domain containing 1
naked mole-rat(101721458) enoyl CoA hydratase domain containing 1
sheep(101116321) enoyl CoA hydratase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018479 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039721 MISSION® esiRNA esiRNA targeting mouse Echdc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002030 Rosetta Predictions human pricing
NM_001105544 Rosetta Predictions human pricing
NM_001105545 Rosetta Predictions human pricing
NM_018479 Rosetta Predictions human pricing
NM_001007734 Rosetta Predictions rat pricing
NM_001110195 Rosetta Predictions mouse pricing
NM_025855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304093 predicted 1024
2 SASI_Hs02_00304094 predicted 1333
3 SASI_Hs02_00304095 predicted 1342
4 SASI_Hs02_00304096 predicted 1218
5 SASI_Hs02_00304097 predicted 1428
6 SASI_Hs02_00304098 predicted 1442
7 SASI_Hs02_00304099 predicted 1342
8 SASI_Hs02_00304100 predicted 1372
9 SASI_Hs02_00304101 predicted 1338
10 SASI_Hs02_00304102 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324321 predicted 802
2 SASI_Hs02_00324322 predicted 1113
3 SASI_Hs02_00324323 predicted 1123
4 SASI_Hs02_00324324 predicted 1002
5 SASI_Hs02_00324325 predicted 1210
6 SASI_Hs02_00324326 predicted 1222
7 SASI_Hs02_00324327 predicted 1123
8 SASI_Hs02_00324328 predicted 1145
9 SASI_Hs02_00324329 predicted 1116
10 SASI_Hs02_00324330 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324331 predicted 753
2 SASI_Hs02_00324332 predicted 939
3 SASI_Hs02_00324333 predicted 944
4 SASI_Hs02_00324334 predicted 794
5 SASI_Hs02_00324335 predicted 750
6 SASI_Hs02_00324336 predicted 944
7 SASI_Hs02_00324337 predicted 937
8 SASI_Hs02_00324338 predicted 923
9 SASI_Hs02_00324339 predicted 929
10 SASI_Hs02_00324340 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099928 predicted 971
2 SASI_Hs02_00352061 predicted 1157
3 SASI_Hs02_00352062 predicted 1171
4 SASI_Hs02_00352063 predicted 1013
5 SASI_Hs02_00352064 predicted 969
6 SASI_Hs02_00352065 predicted 1161
7 SASI_Hs02_00352066 predicted 1162
8 SASI_Hs02_00352067 predicted 1148
9 SASI_Hs02_00352068 predicted 1156
10 SASI_Hs02_00352069 predicted 1140
11 SASI_Hs01_00099922 predicted 607
12 SASI_Hs01_00099923 predicted 301
13 SASI_Hs01_00099924 predicted 684
14 SASI_Hs01_00099925 predicted 691
15 SASI_Hs01_00099926 predicted 565
16 SASI_Hs01_00099927 predicted 773
17 SASI_Hs01_00099929 predicted 473
18 SASI_Hs01_00099930 predicted 928
19 SASI_Hs01_00099931 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198921 predicted 736
2 SASI_Rn01_00033316 predicted 198
3 SASI_Rn01_00033317 predicted 605
4 SASI_Rn01_00033318 predicted 650
5 SASI_Rn01_00033319 predicted 535
6 SASI_Rn01_00033320 predicted 417
7 SASI_Rn01_00033321 predicted 314
8 SASI_Rn01_00033322 predicted 489
9 SASI_Rn01_00033323 predicted 261
10 SASI_Rn02_00198922 predicted 769
11 SASI_Rn01_00033314 predicted 743
12 SASI_Rn01_00033315 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304846 predicted 798
2 SASI_Mm02_00304847 predicted 540
3 SASI_Mm02_00304848 predicted 1007
4 SASI_Mm02_00304849 predicted 734
5 SASI_Mm02_00304850 predicted 785
6 SASI_Mm02_00304851 predicted 994
7 SASI_Mm02_00304852 predicted 732
8 SASI_Mm02_00304853 predicted 1013
9 SASI_Mm02_00304854 predicted 593
10 SASI_Mm02_00304855 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329139 predicted 904
2 SASI_Mm01_00029160 predicted 642
3 SASI_Mm02_00329140 predicted 1113
4 SASI_Mm02_00329141 predicted 831
5 SASI_Mm02_00329142 predicted 890
6 SASI_Mm02_00329143 predicted 1102
7 SASI_Mm02_00329144 predicted 838
8 SASI_Mm02_00329145 predicted 1116
9 SASI_Mm01_00029161 predicted 701
10 SASI_Mm01_00029164 predicted 603
11 SASI_Mm01_00029162 predicted 262
12 SASI_Mm01_00029163 predicted 411
13 SASI_Mm01_00029165 predicted 352
14 SASI_Mm01_00029166 predicted 256
15 SASI_Mm01_00029167 predicted 1083
16 SASI_Mm01_00029168 predicted 493
17 SASI_Mm01_00029169 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025855
VALIDATED
ECHDC1 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025855.2-2285s1c1
Sequence:CCGGGCCCATTGATAGCTTCTCTTTCTCGAGAAAGAGAAGCTATCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.2-986s1c1
Sequence:CCGGCCTGCAAATTTAGAGGCTATTCTCGAGAATAGCCTCTAAATTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.2-411s1c1
Sequence:CCGGGCCTCATTATCCATGGAGCAACTCGAGTTGCTCCATGGATAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.4-288s1c1
Sequence:CCGGCAAACAGGAGTGTCGCTTTATCTCGAGATAAAGCGACACTCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-594s21c1
Sequence:CCGGAGTGGAGTGGCCTTATCTATGCTCGAGCATAGATAAGGCCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-639s21c1
Sequence:CCGGTTTATGAGACTACCGTTAATACTCGAGTATTAACGGTAGTCTCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025855.4-401s21c1
Sequence:CCGGCATTGGCATTCTGACGCTAAACTCGAGTTTAGCGTCAGAATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-288s21c1
Sequence:CCGGCAAACAGGAGTGTCGCTTTATCTCGAGATAAAGCGACACTCCTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-704s21c1
Sequence:CCGGACTTACTACAGCATGTGATTTCTCGAGAAATCACATGCTGTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025855
VALIDATED
ECHDC1 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025855.2-2285s1c1
Sequence:CCGGGCCCATTGATAGCTTCTCTTTCTCGAGAAAGAGAAGCTATCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.2-986s1c1
Sequence:CCGGCCTGCAAATTTAGAGGCTATTCTCGAGAATAGCCTCTAAATTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.2-411s1c1
Sequence:CCGGGCCTCATTATCCATGGAGCAACTCGAGTTGCTCCATGGATAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.4-288s1c1
Sequence:CCGGCAAACAGGAGTGTCGCTTTATCTCGAGATAAAGCGACACTCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-594s21c1
Sequence:CCGGAGTGGAGTGGCCTTATCTATGCTCGAGCATAGATAAGGCCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-639s21c1
Sequence:CCGGTTTATGAGACTACCGTTAATACTCGAGTATTAACGGTAGTCTCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025855.4-401s21c1
Sequence:CCGGCATTGGCATTCTGACGCTAAACTCGAGTTTAGCGTCAGAATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-288s21c1
Sequence:CCGGCAAACAGGAGTGTCGCTTTATCTCGAGATAAAGCGACACTCCTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-704s21c1
Sequence:CCGGACTTACTACAGCATGTGATTTCTCGAGAAATCACATGCTGTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025855
VALIDATED
ECHDC1 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025855.2-2285s1c1
Sequence:CCGGGCCCATTGATAGCTTCTCTTTCTCGAGAAAGAGAAGCTATCAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.2-986s1c1
Sequence:CCGGCCTGCAAATTTAGAGGCTATTCTCGAGAATAGCCTCTAAATTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.2-411s1c1
Sequence:CCGGGCCTCATTATCCATGGAGCAACTCGAGTTGCTCCATGGATAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025855.4-288s1c1
Sequence:CCGGCAAACAGGAGTGTCGCTTTATCTCGAGATAAAGCGACACTCCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-594s21c1
Sequence:CCGGAGTGGAGTGGCCTTATCTATGCTCGAGCATAGATAAGGCCACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-639s21c1
Sequence:CCGGTTTATGAGACTACCGTTAATACTCGAGTATTAACGGTAGTCTCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025855.4-401s21c1
Sequence:CCGGCATTGGCATTCTGACGCTAAACTCGAGTTTAGCGTCAGAATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-288s21c1
Sequence:CCGGCAAACAGGAGTGTCGCTTTATCTCGAGATAAAGCGACACTCCTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025855.4-704s21c1
Sequence:CCGGACTTACTACAGCATGTGATTTCTCGAGAAATCACATGCTGTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018479
VALIDATED
ECHDC1 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-1085s1c1
Sequence:CCGGGCCTGCAAATTTAGAGGCTATCTCGAGATAGCCTCTAAATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-758s1c1
Sequence:CCGGCCACAAAGAGATGGGCATAATCTCGAGATTATGCCCATCTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-468s1c1
Sequence:CCGGCCAAGTAGAATGAATGCCTTTCTCGAGAAAGGCATTCATTCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018479.1-1041s1c1
Sequence:CCGGGCATTACAGAACGAAAGAGATCTCGAGATCTCTTTCGTTCTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018479.1-634s1c1
Sequence:CCGGCCCAGAGGAGACTTCCTTTAACTCGAGTTAAAGGAAGTCTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-648s21c1
Sequence:CCGGTAATAAGTGTTGCGCTGGTTCCTCGAGGAACCAGCGCAACACTTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-633s21c1
Sequence:CCGGTCCAGAGACTTCCTTTAATAACTCGAGTTATTAAAGGAAGTCTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-352s21c1
Sequence:CCGGTATAGTACATCCCATGGATTTCTCGAGAAATCCATGGGATGTACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-697s21c1
Sequence:CCGGATTTACTACAGCATGTGATTTCTCGAGAAATCACATGCTGTAGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-327s21c1
Sequence:CCGGGCTACATCAAACAGGATTGTCCTCGAGGACAATCCTGTTTGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-460s21c1
Sequence:CCGGACTCTGAACAATCCAAGTAGACTCGAGTCTACTTGGATTGTTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-447s21c1
Sequence:CCGGCATTGGCATTCTTACTCTGAACTCGAGTTCAGAGTAAGAATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-404s21c1
Sequence:CCGGAGTTTCCTGGTGGATCCATTGCTCGAGCAATGGATCCACCAGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018479
VALIDATED
ECHDC1 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-1085s1c1
Sequence:CCGGGCCTGCAAATTTAGAGGCTATCTCGAGATAGCCTCTAAATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-758s1c1
Sequence:CCGGCCACAAAGAGATGGGCATAATCTCGAGATTATGCCCATCTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-468s1c1
Sequence:CCGGCCAAGTAGAATGAATGCCTTTCTCGAGAAAGGCATTCATTCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018479.1-1041s1c1
Sequence:CCGGGCATTACAGAACGAAAGAGATCTCGAGATCTCTTTCGTTCTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018479.1-634s1c1
Sequence:CCGGCCCAGAGGAGACTTCCTTTAACTCGAGTTAAAGGAAGTCTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-648s21c1
Sequence:CCGGTAATAAGTGTTGCGCTGGTTCCTCGAGGAACCAGCGCAACACTTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-633s21c1
Sequence:CCGGTCCAGAGACTTCCTTTAATAACTCGAGTTATTAAAGGAAGTCTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-352s21c1
Sequence:CCGGTATAGTACATCCCATGGATTTCTCGAGAAATCCATGGGATGTACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-697s21c1
Sequence:CCGGATTTACTACAGCATGTGATTTCTCGAGAAATCACATGCTGTAGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-327s21c1
Sequence:CCGGGCTACATCAAACAGGATTGTCCTCGAGGACAATCCTGTTTGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-460s21c1
Sequence:CCGGACTCTGAACAATCCAAGTAGACTCGAGTCTACTTGGATTGTTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-447s21c1
Sequence:CCGGCATTGGCATTCTTACTCTGAACTCGAGTTCAGAGTAAGAATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-404s21c1
Sequence:CCGGAGTTTCCTGGTGGATCCATTGCTCGAGCAATGGATCCACCAGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018479
VALIDATED
ECHDC1 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-1085s1c1
Sequence:CCGGGCCTGCAAATTTAGAGGCTATCTCGAGATAGCCTCTAAATTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-758s1c1
Sequence:CCGGCCACAAAGAGATGGGCATAATCTCGAGATTATGCCCATCTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018479.1-468s1c1
Sequence:CCGGCCAAGTAGAATGAATGCCTTTCTCGAGAAAGGCATTCATTCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_018479.1-1041s1c1
Sequence:CCGGGCATTACAGAACGAAAGAGATCTCGAGATCTCTTTCGTTCTGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018479.1-634s1c1
Sequence:CCGGCCCAGAGGAGACTTCCTTTAACTCGAGTTAAAGGAAGTCTCCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-648s21c1
Sequence:CCGGTAATAAGTGTTGCGCTGGTTCCTCGAGGAACCAGCGCAACACTTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-633s21c1
Sequence:CCGGTCCAGAGACTTCCTTTAATAACTCGAGTTATTAAAGGAAGTCTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-352s21c1
Sequence:CCGGTATAGTACATCCCATGGATTTCTCGAGAAATCCATGGGATGTACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-697s21c1
Sequence:CCGGATTTACTACAGCATGTGATTTCTCGAGAAATCACATGCTGTAGTAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-327s21c1
Sequence:CCGGGCTACATCAAACAGGATTGTCCTCGAGGACAATCCTGTTTGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-460s21c1
Sequence:CCGGACTCTGAACAATCCAAGTAGACTCGAGTCTACTTGGATTGTTCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-447s21c1
Sequence:CCGGCATTGGCATTCTTACTCTGAACTCGAGTTCAGAGTAAGAATGCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018479.3-404s21c1
Sequence:CCGGAGTTTCCTGGTGGATCCATTGCTCGAGCAATGGATCCACCAGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks