EMAIL THIS PAGE TO A FRIEND

ECHDC2

enoyl CoA hydratase domain containing 2

51 Gene Product Result for
UniProtKB ID: Q86YB7, D3DQ36, Q9NV38
Gene ID:
Mouse(52430) enoyl Coenzyme A hydratase domain containing 2
Rat(298381) enoyl CoA hydratase domain containing 2
domestic guinea pig(100725535) enoyl CoA hydratase domain containing 2
naked mole-rat(101706021) enoyl CoA hydratase domain containing 2
Zebrafish(338247) enoyl CoA hydratase domain containing 2
chicken(424646) enoyl CoA hydratase domain containing 2
domestic cat(101092131) enoyl CoA hydratase domain containing 2
cow(513795) enoyl CoA hydratase domain containing 2
dog(610733) enoyl CoA hydratase domain containing 2
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_027252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018281 Rosetta Predictions human pricing
NM_001106675 Rosetta Predictions rat pricing
NM_026728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111448 predicted 946
2 SASI_Hs01_00111449 predicted 913
3 SASI_Hs01_00111450 predicted 780
4 SASI_Hs01_00111451 predicted 931
5 SASI_Hs02_00351655 predicted 361
6 SASI_Hs01_00111453 predicted 315
7 SASI_Hs02_00351656 predicted 216
8 SASI_Hs01_00111454 predicted 931
9 SASI_Hs02_00351657 predicted 242
10 SASI_Hs02_00351658 predicted 384
11 SASI_Hs01_00111452 predicted 800
12 SASI_Hs01_00111455 predicted 731
13 SASI_Hs01_00111456 predicted 690
14 SASI_Hs01_00111457 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221278 predicted 452
2 SASI_Rn02_00221279 predicted 667
3 SASI_Rn02_00221280 predicted 458
4 SASI_Rn02_00221281 predicted 923
5 SASI_Rn02_00221282 predicted 1023
6 SASI_Rn02_00221283 predicted 837
7 SASI_Rn02_00221284 predicted 933
8 SASI_Rn02_00221285 predicted 203
9 SASI_Rn02_00221286 predicted 664
10 SASI_Rn02_00221287 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117051 predicted 428
2 SASI_Mm01_00117052 predicted 642
3 SASI_Mm01_00117053 predicted 883
4 SASI_Mm01_00117054 predicted 911
5 SASI_Mm01_00117055 predicted 809
6 SASI_Mm01_00117056 predicted 869
7 SASI_Mm01_00117057 predicted 899
8 SASI_Mm01_00117059 predicted 482
9 SASI_Mm01_00117060 predicted 819
10 SASI_Mm02_00330773 predicted 678
11 SASI_Mm01_00117058 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018281
VALIDATED
ECHDC2 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-270s21c1
Sequence:CCGGGGGAATGTCTTCGTCAGTGAGCTCGAGCTCACTGACGAAGACATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-769s21c1
Sequence:CCGGTTGCATCTGGGATGGCCATTGCTCGAGCAATGGCCATCCCAGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-737s21c1
Sequence:CCGGAGTAGCCATTGACCGAGGAACCTCGAGGTTCCTCGGTCAATGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-393s21c1
Sequence:CCGGGAGCGGGAACAGATGAGTGAACTCGAGTTCACTCATCTGTTCCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018281.1-400s1c1
Sequence:CCGGGCCTGATGAATGACATCGCTTCTCGAGAAGCGATGTCATTCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-680s1c1
Sequence:CCGGGCTGGGCAAAGTAGCCATTAACTCGAGTTAATGGCTACTTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-176s1c1
Sequence:CCGGGATCACTGAGATTCTGATGAACTCGAGTTCATCAGAATCTCAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-815s1c1
Sequence:CCGGGACTCCCAAATTTGTTGGCAACTCGAGTTGCCAACAAATTTGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-293s1c1
Sequence:CCGGGCTCTTCAGAAGTGGAGTGAACTCGAGTTCACTCCACTTCTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018281
VALIDATED
ECHDC2 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-270s21c1
Sequence:CCGGGGGAATGTCTTCGTCAGTGAGCTCGAGCTCACTGACGAAGACATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-769s21c1
Sequence:CCGGTTGCATCTGGGATGGCCATTGCTCGAGCAATGGCCATCCCAGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-737s21c1
Sequence:CCGGAGTAGCCATTGACCGAGGAACCTCGAGGTTCCTCGGTCAATGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-393s21c1
Sequence:CCGGGAGCGGGAACAGATGAGTGAACTCGAGTTCACTCATCTGTTCCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018281.1-400s1c1
Sequence:CCGGGCCTGATGAATGACATCGCTTCTCGAGAAGCGATGTCATTCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-680s1c1
Sequence:CCGGGCTGGGCAAAGTAGCCATTAACTCGAGTTAATGGCTACTTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-176s1c1
Sequence:CCGGGATCACTGAGATTCTGATGAACTCGAGTTCATCAGAATCTCAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-815s1c1
Sequence:CCGGGACTCCCAAATTTGTTGGCAACTCGAGTTGCCAACAAATTTGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-293s1c1
Sequence:CCGGGCTCTTCAGAAGTGGAGTGAACTCGAGTTCACTCCACTTCTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018281
VALIDATED
ECHDC2 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-270s21c1
Sequence:CCGGGGGAATGTCTTCGTCAGTGAGCTCGAGCTCACTGACGAAGACATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-769s21c1
Sequence:CCGGTTGCATCTGGGATGGCCATTGCTCGAGCAATGGCCATCCCAGATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-737s21c1
Sequence:CCGGAGTAGCCATTGACCGAGGAACCTCGAGGTTCCTCGGTCAATGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018281.2-393s21c1
Sequence:CCGGGAGCGGGAACAGATGAGTGAACTCGAGTTCACTCATCTGTTCCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018281.1-400s1c1
Sequence:CCGGGCCTGATGAATGACATCGCTTCTCGAGAAGCGATGTCATTCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-680s1c1
Sequence:CCGGGCTGGGCAAAGTAGCCATTAACTCGAGTTAATGGCTACTTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-176s1c1
Sequence:CCGGGATCACTGAGATTCTGATGAACTCGAGTTCATCAGAATCTCAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-815s1c1
Sequence:CCGGGACTCCCAAATTTGTTGGCAACTCGAGTTGCCAACAAATTTGGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018281.1-293s1c1
Sequence:CCGGGCTCTTCAGAAGTGGAGTGAACTCGAGTTCACTCCACTTCTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026728
ECHDC2 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026728.2-933s1c1
Sequence:CCGGCTTTAAGCACACACCATAAAGCTCGAGCTTTATGGTGTGTGCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-787s21c1
Sequence:CCGGGAGGAATGGAGGTGGACATTGCTCGAGCAATGTCCACCTCCATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-891s21c1
Sequence:CCGGGAGAAACGAGCTCCCAAATTTCTCGAGAAATTTGGGAGCTCGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026728.2-942s21c1
Sequence:CCGGCACACCATAAAGTCTAGATCACTCGAGTGATCTAGACTTTATGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-648s21c1
Sequence:CCGGCGTGAGTTGGGCCTGGTAAATCTCGAGATTTACCAGGCCCAACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-917s21c1
Sequence:CCGGCAAGTGACCCAGCTAACTTTACTCGAGTAAAGTTAGCTGGGTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026728
ECHDC2 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026728.2-933s1c1
Sequence:CCGGCTTTAAGCACACACCATAAAGCTCGAGCTTTATGGTGTGTGCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-787s21c1
Sequence:CCGGGAGGAATGGAGGTGGACATTGCTCGAGCAATGTCCACCTCCATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-891s21c1
Sequence:CCGGGAGAAACGAGCTCCCAAATTTCTCGAGAAATTTGGGAGCTCGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026728.2-942s21c1
Sequence:CCGGCACACCATAAAGTCTAGATCACTCGAGTGATCTAGACTTTATGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-648s21c1
Sequence:CCGGCGTGAGTTGGGCCTGGTAAATCTCGAGATTTACCAGGCCCAACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-917s21c1
Sequence:CCGGCAAGTGACCCAGCTAACTTTACTCGAGTAAAGTTAGCTGGGTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026728
ECHDC2 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026728.2-933s1c1
Sequence:CCGGCTTTAAGCACACACCATAAAGCTCGAGCTTTATGGTGTGTGCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-787s21c1
Sequence:CCGGGAGGAATGGAGGTGGACATTGCTCGAGCAATGTCCACCTCCATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-891s21c1
Sequence:CCGGGAGAAACGAGCTCCCAAATTTCTCGAGAAATTTGGGAGCTCGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026728.2-942s21c1
Sequence:CCGGCACACCATAAAGTCTAGATCACTCGAGTGATCTAGACTTTATGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-648s21c1
Sequence:CCGGCGTGAGTTGGGCCTGGTAAATCTCGAGATTTACCAGGCCCAACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026728.2-917s21c1
Sequence:CCGGCAAGTGACCCAGCTAACTTTACTCGAGTAAAGTTAGCTGGGTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027252
ECHDC2 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 2
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000195893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027252.1-902s1c1
Sequence:CCGGCTCCCAAATTTGTGGGCAAGTCTCGAGACTTGCCCACAAATTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027252.1-820s1c1
Sequence:CCGGGCCATAGAACAGATGTGCTATCTCGAGATAGCACATCTGTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027252
ECHDC2 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 2
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000195893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027252.1-902s1c1
Sequence:CCGGCTCCCAAATTTGTGGGCAAGTCTCGAGACTTGCCCACAAATTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027252.1-820s1c1
Sequence:CCGGGCCATAGAACAGATGTGCTATCTCGAGATAGCACATCTGTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027252
ECHDC2 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 2
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000195893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027252.1-902s1c1
Sequence:CCGGCTCCCAAATTTGTGGGCAAGTCTCGAGACTTGCCCACAAATTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027252.1-820s1c1
Sequence:CCGGGCCATAGAACAGATGTGCTATCTCGAGATAGCACATCTGTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks