EMAIL THIS PAGE TO A FRIEND

ECHDC3

enoyl CoA hydratase domain containing 3

40 Gene Product Result for
UniProtKB ID: Q96DC8, Q53HR9, Q5W0J7, Q8WYY8, Q9BVL8, Q9H7G4
Gene ID:
Mouse(67856) enoyl Coenzyme A hydratase domain containing 3
Rat(684538) enoyl CoA hydratase domain containing 3
chicken(419098) enoyl CoA hydratase domain containing 3
dog(487131) enoyl CoA hydratase domain containing 3
cow(617368) enoyl CoA hydratase domain containing 3
domestic cat(101085386) enoyl CoA hydratase domain containing 3
naked mole-rat(101706882) enoyl CoA hydratase domain containing 3
domestic guinea pig(100723556) enoyl CoA hydratase domain containing 3
sheep(101108411) enoyl CoA hydratase domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48911 Anti-ECHDC3 antibody produced in rabbit IgG fraction of antiserum zebrafish, rabbit, human, mouse, rat, bovine, guinea pig
western blot pricing
HPA038306 Anti-ECHDC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057231 MISSION® esiRNA esiRNA human ECHDC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024693 Rosetta Predictions human pricing
NM_001101010 Rosetta Predictions rat pricing
NM_024208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161075 predicted 909
2 SASI_Hs01_00161076 predicted 563
3 SASI_Hs01_00161077 predicted 1252
4 SASI_Hs01_00161078 predicted 687
5 SASI_Hs01_00161079 predicted 1395
6 SASI_Hs01_00161080 predicted 1225
7 SASI_Hs01_00161081 predicted 593
8 SASI_Hs01_00161082 predicted 1233
9 SASI_Hs01_00161083 predicted 598
10 SASI_Hs01_00161084 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211226 predicted 417
2 SASI_Rn02_00211227 predicted 306
3 SASI_Rn02_00211228 predicted 953
4 SASI_Rn02_00211229 predicted 199
5 SASI_Rn02_00211230 predicted 268
6 SASI_Rn02_00211231 predicted 724
7 SASI_Rn02_00211232 predicted 308
8 SASI_Rn02_00211233 predicted 874
9 SASI_Rn02_00211234 predicted 301
10 SASI_Rn02_00211235 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085841 predicted 261
2 SASI_Mm02_00327566 predicted 997
3 SASI_Mm01_00085842 predicted 952
4 SASI_Mm01_00085843 predicted 276
5 SASI_Mm01_00085845 predicted 424
6 SASI_Mm01_00085846 predicted 613
7 SASI_Mm01_00085847 predicted 1056
8 SASI_Mm01_00085848 predicted 619
9 SASI_Mm01_00085849 predicted 1005
10 SASI_Mm01_00085850 predicted 1211
11 SASI_Mm01_00085844 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024208
VALIDATED
ECHDC3 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024208.3-387s1c1
Sequence:CCGGCGTGATTATCACGCTGAGGTACTCGAGTACCTCAGCGTGATAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024208.3-1051s1c1
Sequence:CCGGGCCAGCCTTTCTAACTTGGATCTCGAGATCCAAGTTAGAAAGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024208.3-1462s1c1
Sequence:CCGGGCTGGGTCATTTCATTTCTAACTCGAGTTAGAAATGAAATGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-549s21c1
Sequence:CCGGTTGCAACTCCTGGAGTGAATGCTCGAGCATTCACTCCAGGAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-297s21c1
Sequence:CCGGGTGAAGACCTGAAAGTCATTACTCGAGTAATGACTTTCAGGTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-504s21c1
Sequence:CCGGTCGTGGCCAGCTGTGATATTGCTCGAGCAATATCACAGCTGGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024208.4-373s21c1
Sequence:CCGGAGATGCACAAGGCCGTGATTACTCGAGTAATCACGGCCTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024208
VALIDATED
ECHDC3 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024208.3-387s1c1
Sequence:CCGGCGTGATTATCACGCTGAGGTACTCGAGTACCTCAGCGTGATAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024208.3-1051s1c1
Sequence:CCGGGCCAGCCTTTCTAACTTGGATCTCGAGATCCAAGTTAGAAAGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024208.3-1462s1c1
Sequence:CCGGGCTGGGTCATTTCATTTCTAACTCGAGTTAGAAATGAAATGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-549s21c1
Sequence:CCGGTTGCAACTCCTGGAGTGAATGCTCGAGCATTCACTCCAGGAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-297s21c1
Sequence:CCGGGTGAAGACCTGAAAGTCATTACTCGAGTAATGACTTTCAGGTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-504s21c1
Sequence:CCGGTCGTGGCCAGCTGTGATATTGCTCGAGCAATATCACAGCTGGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024208.4-373s21c1
Sequence:CCGGAGATGCACAAGGCCGTGATTACTCGAGTAATCACGGCCTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024208
VALIDATED
ECHDC3 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024208.3-387s1c1
Sequence:CCGGCGTGATTATCACGCTGAGGTACTCGAGTACCTCAGCGTGATAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024208.3-1051s1c1
Sequence:CCGGGCCAGCCTTTCTAACTTGGATCTCGAGATCCAAGTTAGAAAGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024208.3-1462s1c1
Sequence:CCGGGCTGGGTCATTTCATTTCTAACTCGAGTTAGAAATGAAATGACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-549s21c1
Sequence:CCGGTTGCAACTCCTGGAGTGAATGCTCGAGCATTCACTCCAGGAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-297s21c1
Sequence:CCGGGTGAAGACCTGAAAGTCATTACTCGAGTAATGACTTTCAGGTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_024208.4-504s21c1
Sequence:CCGGTCGTGGCCAGCTGTGATATTGCTCGAGCAATATCACAGCTGGCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024208.4-373s21c1
Sequence:CCGGAGATGCACAAGGCCGTGATTACTCGAGTAATCACGGCCTTGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024693
ECHDC3 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-356s1c1
Sequence:CCGGCGGCATAAGGAACATCGTCTTCTCGAGAAGACGATGTTCCTTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-371s1c1
Sequence:CCGGCGTCTTGAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-546s1c1
Sequence:CCGGCGTGATTACCATGCCGAAGTACTCGAGTACTTCGGCATGGTAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-559s1c1
Sequence:CCGGCCGAAGTATTTCAGACCTGTTCTCGAGAACAGGTCTGAAATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-457s1c1
Sequence:CCGGGCAACGATCTGAAAGTCATTACTCGAGTAATGACTTTCAGATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1256s21c1
Sequence:CCGGCATAGCATTTGGCCTACATTACTCGAGTAATGTAGGCCAAATGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1393s21c1
Sequence:CCGGGTGCTCCTTGCAACGTCTTAACTCGAGTTAAGACGTTGCAAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1229s21c1
Sequence:CCGGGCTGCTTTCGTGACTTGATATCTCGAGATATCAAGTCACGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024693
ECHDC3 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-356s1c1
Sequence:CCGGCGGCATAAGGAACATCGTCTTCTCGAGAAGACGATGTTCCTTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-371s1c1
Sequence:CCGGCGTCTTGAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-546s1c1
Sequence:CCGGCGTGATTACCATGCCGAAGTACTCGAGTACTTCGGCATGGTAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-559s1c1
Sequence:CCGGCCGAAGTATTTCAGACCTGTTCTCGAGAACAGGTCTGAAATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-457s1c1
Sequence:CCGGGCAACGATCTGAAAGTCATTACTCGAGTAATGACTTTCAGATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1256s21c1
Sequence:CCGGCATAGCATTTGGCCTACATTACTCGAGTAATGTAGGCCAAATGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1393s21c1
Sequence:CCGGGTGCTCCTTGCAACGTCTTAACTCGAGTTAAGACGTTGCAAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1229s21c1
Sequence:CCGGGCTGCTTTCGTGACTTGATATCTCGAGATATCAAGTCACGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024693
ECHDC3 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-356s1c1
Sequence:CCGGCGGCATAAGGAACATCGTCTTCTCGAGAAGACGATGTTCCTTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-371s1c1
Sequence:CCGGCGTCTTGAGCAATCCCAAGAACTCGAGTTCTTGGGATTGCTCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-546s1c1
Sequence:CCGGCGTGATTACCATGCCGAAGTACTCGAGTACTTCGGCATGGTAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-559s1c1
Sequence:CCGGCCGAAGTATTTCAGACCTGTTCTCGAGAACAGGTCTGAAATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024693.2-457s1c1
Sequence:CCGGGCAACGATCTGAAAGTCATTACTCGAGTAATGACTTTCAGATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1256s21c1
Sequence:CCGGCATAGCATTTGGCCTACATTACTCGAGTAATGTAGGCCAAATGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1393s21c1
Sequence:CCGGGTGCTCCTTGCAACGTCTTAACTCGAGTTAAGACGTTGCAAGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024693.4-1229s21c1
Sequence:CCGGGCTGCTTTCGTGACTTGATATCTCGAGATATCAAGTCACGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks