EMAIL THIS PAGE TO A FRIEND

ECHS1

enoyl CoA hydratase, short chain, 1, mitochondrial

61 Gene Product Result for
Synonyms: SCEH
UniProtKB ID: P30084, O00739, Q5VWY1, Q96H54
Gene ID:
Human(1892) Summary: The protein encoded by this gene functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. It catalyzes the hydration of 2-trans-enoyl-coenzyme A (CoA) intermediates to L-3-hydroxyacyl-CoAs. The gene product is a member of the hydratase/isomerase superfamily. It localizes to the mitochondrial matrix. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. [provided by RefSeq, Jul 2008]
Mouse(93747) enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Rat(140547) enoyl CoA hydratase, short chain, 1, mitochondrial
Zebrafish(368912) enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
dog(480828) enoyl CoA hydratase, short chain, 1, mitochondrial
domestic cat(101089898) enoyl CoA hydratase, short chain, 1, mitochondrial
cow(281748) enoyl CoA hydratase, short chain, 1, mitochondrial
chicken(770828) enoyl CoA hydratase, short chain, 1, mitochondrial
domestic guinea pig(100728489) enoyl CoA hydratase, short chain, 1, mitochondrial
naked mole-rat(101697414) enoyl CoA hydratase, short chain, 1, mitochondrial
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV45699 Anti-ECHS1 (AB1) antibody produced in rabbit IgG fraction of antiserum canine, rat, bovine, human, rabbit, pig, zebrafish, horse, mouse, guinea pig
western blot pricing
AV45700 Anti-ECHS1 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, human, rat, guinea pig, rabbit, mouse, horse,
western blot pricing
SAB1405740 Anti-ECHS1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA021995 Anti-ECHS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA022476 Anti-ECHS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100643 Anti-ECHS1 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, mouse, horse, bovine, human, rat, sheep
western blot pricing
WH0001892M1 Monoclonal Anti-ECHS1 antibody produced in mouse clone 1G9, ascites fluid, buffered aqueous solution human
ELISA pricing
SAB1403754 Monoclonal Anti-ECHS1, (C-terminal) antibody produced in mouse clone 3C6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004092 Rosetta Predictions human pricing
NM_078623 Rosetta Predictions rat pricing
NM_053119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085563 predicted 872
2 SASI_Hs02_00336896 predicted 892
3 SASI_Hs01_00085565 predicted 1045
4 SASI_Hs01_00085566 predicted 837
5 SASI_Hs01_00085567 predicted 1096
6 SASI_Hs01_00085568 predicted 870
7 SASI_Hs01_00085570 predicted 240
8 SASI_Hs01_00085571 predicted 1052
9 SASI_Hs02_00336897 predicted 828
10 SASI_Hs02_00336898 predicted 536
11 SASI_Hs01_00085564 predicted 501
12 SASI_Hs01_00085569 predicted 955
13 SASI_Hs01_00085572 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093579 predicted 653
2 SASI_Rn02_00267202 predicted 705
3 SASI_Rn01_00093580 predicted 1175
4 SASI_Rn01_00093581 predicted 380
5 SASI_Rn01_00093582 predicted 733
6 SASI_Rn01_00093583 predicted 787
7 SASI_Rn01_00093584 predicted 330
8 SASI_Rn01_00093585 predicted 618
9 SASI_Rn02_00267203 predicted 750
10 SASI_Rn01_00093586 predicted 865
11 SASI_Rn01_00093587 predicted 211
12 SASI_Rn01_00093588 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059906 predicted 851
2 SASI_Mm01_00059907 predicted 338
3 SASI_Mm01_00059909 predicted 763
4 SASI_Mm01_00059910 predicted 422
5 SASI_Mm02_00337629 predicted 762
6 SASI_Mm01_00059911 predicted 618
7 SASI_Mm01_00059912 predicted 233
8 SASI_Mm01_00059913 predicted 363
9 SASI_Mm01_00059914 predicted 410
10 SASI_Mm02_00337630 predicted 499
11 SASI_Mm01_00059908 predicted 468
12 SASI_Mm01_00059915 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004092
VALIDATED
ECHS1 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase, short chain, 1, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-1133s21c1
Sequence:CCGGCTGACTGGAGCACCTTCTAAACTCGAGTTTAGAAGGTGCTCCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-503s21c1
Sequence:CCGGGCTTGCCATGATGTGTGATATCTCGAGATATCACACATCATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-386s21c1
Sequence:CCGGCCTGAGTTTCCAGGACTGTTACTCGAGTAACAGTCCTGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-550s21c1
Sequence:CCGGTTGCACAGCCGGAGATCTTAACTCGAGTTAAGATCTCCGGCTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004092.3-833s21c1
Sequence:CCGGAGGAAGTAAGTTGGAGAAGAACTCGAGTTCTTCTCCAACTTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-503s1c1
Sequence:CCGGGCTTGCCATGATGTGTGATATCTCGAGATATCACACATCATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-468s1c1
Sequence:CCGGGCTGTCAATGGCTATGCCTTTCTCGAGAAAGGCATAGCCATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004092.2-833s1c1
Sequence:CCGGAGGAAGTAAGTTGGAGAAGAACTCGAGTTCTTCTCCAACTTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-696s1c1
Sequence:CCGGGTCAGCAAGATTTGTCCTGTTCTCGAGAACAGGACAAATCTTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-386s1c1
Sequence:CCGGCCTGAGTTTCCAGGACTGTTACTCGAGTAACAGTCCTGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004092
VALIDATED
ECHS1 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase, short chain, 1, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-1133s21c1
Sequence:CCGGCTGACTGGAGCACCTTCTAAACTCGAGTTTAGAAGGTGCTCCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-503s21c1
Sequence:CCGGGCTTGCCATGATGTGTGATATCTCGAGATATCACACATCATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-386s21c1
Sequence:CCGGCCTGAGTTTCCAGGACTGTTACTCGAGTAACAGTCCTGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-550s21c1
Sequence:CCGGTTGCACAGCCGGAGATCTTAACTCGAGTTAAGATCTCCGGCTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004092.3-833s21c1
Sequence:CCGGAGGAAGTAAGTTGGAGAAGAACTCGAGTTCTTCTCCAACTTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-503s1c1
Sequence:CCGGGCTTGCCATGATGTGTGATATCTCGAGATATCACACATCATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-468s1c1
Sequence:CCGGGCTGTCAATGGCTATGCCTTTCTCGAGAAAGGCATAGCCATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004092.2-833s1c1
Sequence:CCGGAGGAAGTAAGTTGGAGAAGAACTCGAGTTCTTCTCCAACTTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-696s1c1
Sequence:CCGGGTCAGCAAGATTTGTCCTGTTCTCGAGAACAGGACAAATCTTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-386s1c1
Sequence:CCGGCCTGAGTTTCCAGGACTGTTACTCGAGTAACAGTCCTGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004092
VALIDATED
ECHS1 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase, short chain, 1, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-1133s21c1
Sequence:CCGGCTGACTGGAGCACCTTCTAAACTCGAGTTTAGAAGGTGCTCCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-503s21c1
Sequence:CCGGGCTTGCCATGATGTGTGATATCTCGAGATATCACACATCATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-386s21c1
Sequence:CCGGCCTGAGTTTCCAGGACTGTTACTCGAGTAACAGTCCTGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004092.3-550s21c1
Sequence:CCGGTTGCACAGCCGGAGATCTTAACTCGAGTTAAGATCTCCGGCTGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004092.3-833s21c1
Sequence:CCGGAGGAAGTAAGTTGGAGAAGAACTCGAGTTCTTCTCCAACTTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-503s1c1
Sequence:CCGGGCTTGCCATGATGTGTGATATCTCGAGATATCACACATCATGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-468s1c1
Sequence:CCGGGCTGTCAATGGCTATGCCTTTCTCGAGAAAGGCATAGCCATTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004092.2-833s1c1
Sequence:CCGGAGGAAGTAAGTTGGAGAAGAACTCGAGTTCTTCTCCAACTTACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-696s1c1
Sequence:CCGGGTCAGCAAGATTTGTCCTGTTCTCGAGAACAGGACAAATCTTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004092.2-386s1c1
Sequence:CCGGCCTGAGTTTCCAGGACTGTTACTCGAGTAACAGTCCTGGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053119
VALIDATED
ECHS1 MISSION shRNA Bacterial Glycerol Stock
enoyl CoA hydratase, short chain, 1, mitochondrial
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-344s21c1
Sequence:CCGGCCGAACATTTCAGGACTGTTACTCGAGTAACAGTCCTGAAATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-765s21c1
Sequence:CCGGGCAGCCTTTGAGATGACGTTACTCGAGTAACGTCATCTCAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-753s21c1
Sequence:CCGGGAATCTGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053119.2-955s21c1
Sequence:CCGGGAGGCAAATAAATGATCCAAACTCGAGTTTGGATCATTTATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053119.1-334s1c1
Sequence:CCGGGAAATGCAGAACCGAACATTTCTCGAGAAATGTTCGGTTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-766s1c1
Sequence:CCGGGCAGCCTTTGAGATGACGTTACTCGAGTAACGTCATCTCAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-1117s1c1
Sequence:CCGGGCTTTCAAGGTGTCTTGATTTCTCGAGAAATCAAGACACCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053119.1-427s1c1
Sequence:CCGGGCTGTCAATGGTTATGCTCTTCTCGAGAAGAGCATAACCATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-956s1c1
Sequence:CCGGGAGGCAAATAAATGATCCAAACTCGAGTTTGGATCATTTATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-345s1c1
Sequence:CCGGCCGAACATTTCAGGACTGTTACTCGAGTAACAGTCCTGAAATGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-754s1c1
Sequence:CCGGGAATCTGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053119
VALIDATED
ECHS1 MISSION shRNA shRNA Plasmid DNA
enoyl CoA hydratase, short chain, 1, mitochondrial
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-344s21c1
Sequence:CCGGCCGAACATTTCAGGACTGTTACTCGAGTAACAGTCCTGAAATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-765s21c1
Sequence:CCGGGCAGCCTTTGAGATGACGTTACTCGAGTAACGTCATCTCAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-753s21c1
Sequence:CCGGGAATCTGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053119.2-955s21c1
Sequence:CCGGGAGGCAAATAAATGATCCAAACTCGAGTTTGGATCATTTATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053119.1-334s1c1
Sequence:CCGGGAAATGCAGAACCGAACATTTCTCGAGAAATGTTCGGTTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-766s1c1
Sequence:CCGGGCAGCCTTTGAGATGACGTTACTCGAGTAACGTCATCTCAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-1117s1c1
Sequence:CCGGGCTTTCAAGGTGTCTTGATTTCTCGAGAAATCAAGACACCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053119.1-427s1c1
Sequence:CCGGGCTGTCAATGGTTATGCTCTTCTCGAGAAGAGCATAACCATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-956s1c1
Sequence:CCGGGAGGCAAATAAATGATCCAAACTCGAGTTTGGATCATTTATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-345s1c1
Sequence:CCGGCCGAACATTTCAGGACTGTTACTCGAGTAACAGTCCTGAAATGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-754s1c1
Sequence:CCGGGAATCTGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053119
VALIDATED
ECHS1 MISSION shRNA Lentiviral Transduction Particles
enoyl CoA hydratase, short chain, 1, mitochondrial
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-344s21c1
Sequence:CCGGCCGAACATTTCAGGACTGTTACTCGAGTAACAGTCCTGAAATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-765s21c1
Sequence:CCGGGCAGCCTTTGAGATGACGTTACTCGAGTAACGTCATCTCAAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053119.2-753s21c1
Sequence:CCGGGAATCTGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053119.2-955s21c1
Sequence:CCGGGAGGCAAATAAATGATCCAAACTCGAGTTTGGATCATTTATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053119.1-334s1c1
Sequence:CCGGGAAATGCAGAACCGAACATTTCTCGAGAAATGTTCGGTTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-766s1c1
Sequence:CCGGGCAGCCTTTGAGATGACGTTACTCGAGTAACGTCATCTCAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-1117s1c1
Sequence:CCGGGCTTTCAAGGTGTCTTGATTTCTCGAGAAATCAAGACACCTTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053119.1-427s1c1
Sequence:CCGGGCTGTCAATGGTTATGCTCTTCTCGAGAAGAGCATAACCATTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-956s1c1
Sequence:CCGGGAGGCAAATAAATGATCCAAACTCGAGTTTGGATCATTTATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-345s1c1
Sequence:CCGGCCGAACATTTCAGGACTGTTACTCGAGTAACAGTCCTGAAATGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053119.1-754s1c1
Sequence:CCGGGAATCTGTGAATGCAGCCTTTCTCGAGAAAGGCTGCATTCACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks