EMAIL THIS PAGE TO A FRIEND

ECI1

enoyl-CoA delta isomerase 1

53 Gene Product Result for
Synonyms: DCI
Gene ID:
Human(1632) Summary: This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
Mouse(13177) enoyl-Coenzyme A delta isomerase 1
Rat(29740) enoyl-CoA delta isomerase 1
naked mole-rat(101702995) enoyl-CoA delta isomerase 1
domestic guinea pig(100734015) enoyl-CoA delta isomerase 1
sheep(101115592) enoyl-CoA delta isomerase 1
Zebrafish(334101) enoyl-CoA delta isomerase 1
domestic cat(101081106) enoyl-CoA delta isomerase 1
cow(535174) enoyl-CoA delta isomerase 1
dog(490059) enoyl-CoA delta isomerase 1
Thale Cress(842864) delta(3), delta(2)-enoyl CoA isomerase 1
chicken(416657) enoyl-CoA delta isomerase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001919 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001919 Rosetta Predictions human pricing
NM_017306 Rosetta Predictions rat pricing
NM_010023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155059 predicted 792
2 SASI_Hs01_00155060 predicted 539
3 SASI_Hs01_00155061 predicted 768
4 SASI_Hs01_00155062 predicted 548
5 SASI_Hs01_00155063 predicted 540
6 SASI_Hs01_00155064 predicted 385
7 SASI_Hs01_00155065 predicted 511
8 SASI_Hs01_00155066 predicted 594
9 SASI_Hs01_00155067 predicted 726
10 SASI_Hs01_00155068 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261750 predicted 661
2 SASI_Rn01_00077617 predicted 436
3 SASI_Rn01_00077618 predicted 440
4 SASI_Rn01_00077619 predicted 720
5 SASI_Rn01_00077620 predicted 642
6 SASI_Rn02_00261751 predicted 640
7 SASI_Rn01_00077623 predicted 253
8 SASI_Rn02_00261752 predicted 318
9 SASI_Rn02_00261753 predicted 321
10 SASI_Rn01_00077624 predicted 282
11 SASI_Rn01_00077615 predicted 476
12 SASI_Rn01_00077616 predicted 404
13 SASI_Rn01_00077621 predicted 377
14 SASI_Rn01_00077622 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317656 predicted 371
2 SASI_Mm02_00317657 predicted 629
3 SASI_Mm02_00317658 predicted 254
4 SASI_Mm02_00317659 predicted 402
5 SASI_Mm02_00317660 predicted 735
6 SASI_Mm02_00317661 predicted 535
7 SASI_Mm02_00317662 predicted 379
8 SASI_Mm02_00317663 predicted 657
9 SASI_Mm02_00317664 predicted 381
10 SASI_Mm02_00317665 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010023
VALIDATED
ECI1 MISSION shRNA Bacterial Glycerol Stock
enoyl-CoA delta isomerase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-815s1c1
Sequence:CCGGCCAGTTTCATCTCCAAAGACTCTCGAGAGTCTTTGGAGATGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-699s1c1
Sequence:CCGGGATGACCAAGTGGTTAGCTATCTCGAGATAGCTAACCACTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-741s1c1
Sequence:CCGGGACAAAGAACATGATGCGAAACTCGAGTTTCGCATCATGTTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-804s1c1
Sequence:CCGGCCAGAATTTCACCAGTTTCATCTCGAGATGAAACTGGTGAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-735s1c1
Sequence:CCGGGCAGCTGACAAAGAACATGATCTCGAGATCATGTTCTTTGTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-540s1c1
Sequence:CCGGCTTCTGGTTTAAAGACATGTACTCGAGTACATGTCTTTAAACCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-392s1c1
Sequence:CCGGCGTCCAACATGATCTTAGTGTCTCGAGACACTAAGATCATGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-157s1c1
Sequence:CCGGGTGATGAAGTTAAGGAACCCTCTCGAGAGGGTTCCTTAACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.3-765s1c1
Sequence:CCGGACCGCAGACAACCTGATCAAGCTCGAGCTTGATCAGGTTGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.3-260s1c1
Sequence:CCGGTGTCATCCTCACGTCGGAATGCTCGAGCATTCCGACGTGAGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010023
VALIDATED
ECI1 MISSION shRNA shRNA Plasmid DNA
enoyl-CoA delta isomerase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-815s1c1
Sequence:CCGGCCAGTTTCATCTCCAAAGACTCTCGAGAGTCTTTGGAGATGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-699s1c1
Sequence:CCGGGATGACCAAGTGGTTAGCTATCTCGAGATAGCTAACCACTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-741s1c1
Sequence:CCGGGACAAAGAACATGATGCGAAACTCGAGTTTCGCATCATGTTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-804s1c1
Sequence:CCGGCCAGAATTTCACCAGTTTCATCTCGAGATGAAACTGGTGAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-735s1c1
Sequence:CCGGGCAGCTGACAAAGAACATGATCTCGAGATCATGTTCTTTGTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-540s1c1
Sequence:CCGGCTTCTGGTTTAAAGACATGTACTCGAGTACATGTCTTTAAACCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-392s1c1
Sequence:CCGGCGTCCAACATGATCTTAGTGTCTCGAGACACTAAGATCATGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-157s1c1
Sequence:CCGGGTGATGAAGTTAAGGAACCCTCTCGAGAGGGTTCCTTAACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.3-765s1c1
Sequence:CCGGACCGCAGACAACCTGATCAAGCTCGAGCTTGATCAGGTTGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.3-260s1c1
Sequence:CCGGTGTCATCCTCACGTCGGAATGCTCGAGCATTCCGACGTGAGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010023
VALIDATED
ECI1 MISSION shRNA Lentiviral Transduction Particles
enoyl-CoA delta isomerase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-815s1c1
Sequence:CCGGCCAGTTTCATCTCCAAAGACTCTCGAGAGTCTTTGGAGATGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-699s1c1
Sequence:CCGGGATGACCAAGTGGTTAGCTATCTCGAGATAGCTAACCACTTGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-741s1c1
Sequence:CCGGGACAAAGAACATGATGCGAAACTCGAGTTTCGCATCATGTTCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010023.2-804s1c1
Sequence:CCGGCCAGAATTTCACCAGTTTCATCTCGAGATGAAACTGGTGAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-735s1c1
Sequence:CCGGGCAGCTGACAAAGAACATGATCTCGAGATCATGTTCTTTGTCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-540s1c1
Sequence:CCGGCTTCTGGTTTAAAGACATGTACTCGAGTACATGTCTTTAAACCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-392s1c1
Sequence:CCGGCGTCCAACATGATCTTAGTGTCTCGAGACACTAAGATCATGTTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.2-157s1c1
Sequence:CCGGGTGATGAAGTTAAGGAACCCTCTCGAGAGGGTTCCTTAACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.3-765s1c1
Sequence:CCGGACCGCAGACAACCTGATCAAGCTCGAGCTTGATCAGGTTGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010023.3-260s1c1
Sequence:CCGGTGTCATCCTCACGTCGGAATGCTCGAGCATTCCGACGTGAGGATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001919
ECI1 MISSION shRNA Bacterial Glycerol Stock
enoyl-CoA delta isomerase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-179s1c1
Sequence:CCGGCGCTGTGATGAAATTCAAGAACTCGAGTTCTTGAATTTCATCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-830s1c1
Sequence:CCGGGCAGAACTTCGTCAGCTTCATCTCGAGATGAAGCTGACGAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-404s1c1
Sequence:CCGGGCTGCGGTTGTACCAGTCCAACTCGAGTTGGACTGGTACAACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-719s1c1
Sequence:CCGGGTCAGCGATAGCCCAGTGGATCTCGAGATCCACTGGGCTATCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-519s1c1
Sequence:CCGGAGGTACTGCATAGGACTCAATCTCGAGATTGAGTCCTATGCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-558s21c1
Sequence:CCGGAGGACTCAATGAGACCCAGCTCTCGAGAGCTGGGTCTCATTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-772s21c1
Sequence:CCGGATTCCAGACCATGCTCGACAGCTCGAGCTGTCGAGCATGGTCTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-796s21c1
Sequence:CCGGACCAAGGCCATGATGCGAAAGCTCGAGCTTTCGCATCATGGCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-300s21c1
Sequence:CCGGCAAGAGCTTCCGCGGTGTCATCTCGAGATGACACCGCGGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001919
ECI1 MISSION shRNA shRNA Plasmid DNA
enoyl-CoA delta isomerase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-179s1c1
Sequence:CCGGCGCTGTGATGAAATTCAAGAACTCGAGTTCTTGAATTTCATCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-830s1c1
Sequence:CCGGGCAGAACTTCGTCAGCTTCATCTCGAGATGAAGCTGACGAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-404s1c1
Sequence:CCGGGCTGCGGTTGTACCAGTCCAACTCGAGTTGGACTGGTACAACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-719s1c1
Sequence:CCGGGTCAGCGATAGCCCAGTGGATCTCGAGATCCACTGGGCTATCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-519s1c1
Sequence:CCGGAGGTACTGCATAGGACTCAATCTCGAGATTGAGTCCTATGCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-558s21c1
Sequence:CCGGAGGACTCAATGAGACCCAGCTCTCGAGAGCTGGGTCTCATTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-772s21c1
Sequence:CCGGATTCCAGACCATGCTCGACAGCTCGAGCTGTCGAGCATGGTCTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-796s21c1
Sequence:CCGGACCAAGGCCATGATGCGAAAGCTCGAGCTTTCGCATCATGGCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-300s21c1
Sequence:CCGGCAAGAGCTTCCGCGGTGTCATCTCGAGATGACACCGCGGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001919
ECI1 MISSION shRNA Lentiviral Transduction Particles
enoyl-CoA delta isomerase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-179s1c1
Sequence:CCGGCGCTGTGATGAAATTCAAGAACTCGAGTTCTTGAATTTCATCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-830s1c1
Sequence:CCGGGCAGAACTTCGTCAGCTTCATCTCGAGATGAAGCTGACGAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-404s1c1
Sequence:CCGGGCTGCGGTTGTACCAGTCCAACTCGAGTTGGACTGGTACAACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-719s1c1
Sequence:CCGGGTCAGCGATAGCCCAGTGGATCTCGAGATCCACTGGGCTATCGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001919.1-519s1c1
Sequence:CCGGAGGTACTGCATAGGACTCAATCTCGAGATTGAGTCCTATGCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-558s21c1
Sequence:CCGGAGGACTCAATGAGACCCAGCTCTCGAGAGCTGGGTCTCATTGAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-772s21c1
Sequence:CCGGATTCCAGACCATGCTCGACAGCTCGAGCTGTCGAGCATGGTCTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-796s21c1
Sequence:CCGGACCAAGGCCATGATGCGAAAGCTCGAGCTTTCGCATCATGGCCTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001919.2-300s21c1
Sequence:CCGGCAAGAGCTTCCGCGGTGTCATCTCGAGATGACACCGCGGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks