EMAIL THIS PAGE TO A FRIEND

ECI2

enoyl-CoA delta isomerase 2

Synonyms: ACBD2 DRS-1 DRS1 HCA88 PECI dJ1013A10.3
Gene ID:
Human(10455) Summary: This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
Mouse(23986) enoyl-Coenzyme A delta isomerase 2
Rat(291075) enoyl-CoA delta isomerase 2
chicken(420878) enoyl-CoA delta isomerase 2
domestic cat(101083589) enoyl-CoA delta isomerase 2
cow(505355) enoyl-CoA delta isomerase 2
dog(478706) enoyl-CoA delta isomerase 2
sheep(101121214) enoyl-CoA delta isomerase 2
domestic guinea pig(100717738) enoyl-CoA delta isomerase 2
naked mole-rat(101722180) enoyl-CoA delta isomerase 2
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006117 Rosetta Predictions human pricing
NM_206836 Rosetta Predictions human pricing
NM_001006966 Rosetta Predictions rat pricing
NM_001110331 Rosetta Predictions mouse pricing
NM_001110332 Rosetta Predictions mouse pricing
NM_011868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024921 predicted 857
2 SASI_Hs01_00024922 predicted 1159
3 SASI_Hs01_00024923 predicted 1165
4 SASI_Hs01_00024924 predicted 264
5 SASI_Hs01_00024925 predicted 858
6 SASI_Hs02_00340935 predicted 784
7 SASI_Hs01_00024926 predicted 832
8 SASI_Hs01_00024927 predicted 964
9 SASI_Hs02_00340936 predicted 804
10 SASI_Hs02_00340937 predicted 801
11 SASI_Hs01_00024919 predicted 277
12 SASI_Hs01_00024920 predicted 272
13 SASI_Hs01_00024928 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373565 predicted 802
2 SASI_Hs01_00177319 predicted 934
3 SASI_Hs01_00177320 predicted 1234
4 SASI_Hs01_00177321 predicted 1231
5 SASI_Hs01_00177322 predicted 936
6 SASI_Hs01_00177323 predicted 1213
7 SASI_Hs02_00373566 predicted 861
8 SASI_Hs01_00177325 predicted 901
9 SASI_Hs01_00177326 predicted 976
10 SASI_Hs01_00177327 predicted 1032
11 SASI_Hs01_00177324 predicted 1091
12 SASI_Hs01_00177328 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094722 predicted 616
2 SASI_Rn01_00094723 predicted 530
3 SASI_Rn01_00094725 predicted 1197
4 SASI_Rn01_00094726 predicted 191
5 SASI_Rn01_00094728 predicted 1307
6 SASI_Rn01_00094729 predicted 334
7 SASI_Rn01_00094730 predicted 364
8 SASI_Rn01_00094731 predicted 227
9 SASI_Rn02_00198520 predicted 1174
10 SASI_Rn01_00094724 predicted 369
11 SASI_Rn01_00094727 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305458 predicted 575
2 SASI_Mm02_00305459 predicted 669
3 SASI_Mm02_00305460 predicted 731
4 SASI_Mm02_00305461 predicted 909
5 SASI_Mm02_00305462 predicted 523
6 SASI_Mm02_00305463 predicted 814
7 SASI_Mm02_00305464 predicted 513
8 SASI_Mm02_00305465 predicted 1221
9 SASI_Mm02_00305466 predicted 264
10 SASI_Mm02_00305467 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305468 predicted 568
2 SASI_Mm02_00305469 predicted 658
3 SASI_Mm02_00305470 predicted 726
4 SASI_Mm02_00305471 predicted 899
5 SASI_Mm02_00305472 predicted 514
6 SASI_Mm02_00305473 predicted 809
7 SASI_Mm02_00305474 predicted 507
8 SASI_Mm02_00305475 predicted 1214
9 SASI_Mm02_00305476 predicted 250
10 SASI_Mm02_00305477 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151079 predicted 748
2 SASI_Mm01_00151080 predicted 840
3 SASI_Mm01_00151082 predicted 900
4 SASI_Mm01_00151083 predicted 1078
5 SASI_Mm01_00151084 predicted 690
6 SASI_Mm01_00151086 predicted 984
7 SASI_Mm02_00321646 predicted 689
8 SASI_Mm02_00321647 predicted 1383
9 SASI_Mm01_00151081 predicted 427
10 SASI_Mm02_00321648 predicted 1516
11 SASI_Mm01_00151085 predicted 432
12 SASI_Mm01_00151087 predicted 418
13 SASI_Mm01_00151088 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006117
VALIDATED
ECI2 MISSION shRNA Bacterial Glycerol Stock
enoyl-CoA delta isomerase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-1152s21c1
Sequence:CCGGGCTATCAGATGAATGCACAAACTCGAGTTTGTGCATTCATCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006117.2-628s21c1
Sequence:CCGGGATCTGACTAACTTCACTGATCTCGAGATCAGTGAAGTTAGTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-514s21c1
Sequence:CCGGGCCATAAACACTGAGATGTATCTCGAGATACATCTCAGTGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-196s21c1
Sequence:CCGGCCAGGAAACGAAGTGAAGCTACTCGAGTAGCTTCACTTCGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-1152s1c1
Sequence:CCGGGCTATCAGATGAATGCACAAACTCGAGTTTGTGCATTCATCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-628s1c1
Sequence:CCGGGATCTGACTAACTTCACTGATCTCGAGATCAGTGAAGTTAGTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006117.2-823s1c1
Sequence:CCGGGCAACATTTCATACACCATTTCTCGAGAAATGGTGTATGAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006117.2-196s1c1
Sequence:CCGGCCAGGAAACGAAGTGAAGCTACTCGAGTAGCTTCACTTCGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-514s1c1
Sequence:CCGGGCCATAAACACTGAGATGTATCTCGAGATACATCTCAGTGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006117
VALIDATED
ECI2 MISSION shRNA shRNA Plasmid DNA
enoyl-CoA delta isomerase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-1152s21c1
Sequence:CCGGGCTATCAGATGAATGCACAAACTCGAGTTTGTGCATTCATCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006117.2-628s21c1
Sequence:CCGGGATCTGACTAACTTCACTGATCTCGAGATCAGTGAAGTTAGTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-514s21c1
Sequence:CCGGGCCATAAACACTGAGATGTATCTCGAGATACATCTCAGTGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-196s21c1
Sequence:CCGGCCAGGAAACGAAGTGAAGCTACTCGAGTAGCTTCACTTCGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-1152s1c1
Sequence:CCGGGCTATCAGATGAATGCACAAACTCGAGTTTGTGCATTCATCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-628s1c1
Sequence:CCGGGATCTGACTAACTTCACTGATCTCGAGATCAGTGAAGTTAGTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006117.2-823s1c1
Sequence:CCGGGCAACATTTCATACACCATTTCTCGAGAAATGGTGTATGAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006117.2-196s1c1
Sequence:CCGGCCAGGAAACGAAGTGAAGCTACTCGAGTAGCTTCACTTCGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-514s1c1
Sequence:CCGGGCCATAAACACTGAGATGTATCTCGAGATACATCTCAGTGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006117
VALIDATED
ECI2 MISSION shRNA Lentiviral Transduction Particles
enoyl-CoA delta isomerase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-1152s21c1
Sequence:CCGGGCTATCAGATGAATGCACAAACTCGAGTTTGTGCATTCATCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006117.2-628s21c1
Sequence:CCGGGATCTGACTAACTTCACTGATCTCGAGATCAGTGAAGTTAGTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-514s21c1
Sequence:CCGGGCCATAAACACTGAGATGTATCTCGAGATACATCTCAGTGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006117.2-196s21c1
Sequence:CCGGCCAGGAAACGAAGTGAAGCTACTCGAGTAGCTTCACTTCGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-1152s1c1
Sequence:CCGGGCTATCAGATGAATGCACAAACTCGAGTTTGTGCATTCATCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-628s1c1
Sequence:CCGGGATCTGACTAACTTCACTGATCTCGAGATCAGTGAAGTTAGTCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_006117.2-823s1c1
Sequence:CCGGGCAACATTTCATACACCATTTCTCGAGAAATGGTGTATGAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006117.2-196s1c1
Sequence:CCGGCCAGGAAACGAAGTGAAGCTACTCGAGTAGCTTCACTTCGTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006117.2-514s1c1
Sequence:CCGGGCCATAAACACTGAGATGTATCTCGAGATACATCTCAGTGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011868
VALIDATED
ECI2 MISSION shRNA Bacterial Glycerol Stock
enoyl-CoA delta isomerase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.2-909s1c1
Sequence:CCGGGTGTTACTGAGGGACTTTGTACTCGAGTACAAAGTCCCTCAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-840s21c1
Sequence:CCGGAGTGGGAATGACCTGACTAACCTCGAGGTTAGTCAGGTCATTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-997s21c1
Sequence:CCGGTCACCCTTCTGGGACTATTTGCTCGAGCAAATAGTCCCAGAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-490s21c1
Sequence:CCGGAGCCTGGTATGCTTGACTTTGCTCGAGCAAAGTCAAGCATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-748s21c1
Sequence:CCGGAGATGTATCGGGATATTATACCTCGAGGTATAATATCCCGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-1431s21c1
Sequence:CCGGAGACCACCACAGCAGCTAGACCTCGAGGTCTAGCTGCTGTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.1-773s1c1
Sequence:CCGGCCAGCACTGATAACACTGTCACTCGAGTGACAGTGTTATCAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.1-451s1c1
Sequence:CCGGGCCACAGAAGGAACCTGTAATCTCGAGATTACAGGTTCCTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011868
VALIDATED
ECI2 MISSION shRNA shRNA Plasmid DNA
enoyl-CoA delta isomerase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.2-909s1c1
Sequence:CCGGGTGTTACTGAGGGACTTTGTACTCGAGTACAAAGTCCCTCAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-840s21c1
Sequence:CCGGAGTGGGAATGACCTGACTAACCTCGAGGTTAGTCAGGTCATTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-997s21c1
Sequence:CCGGTCACCCTTCTGGGACTATTTGCTCGAGCAAATAGTCCCAGAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-490s21c1
Sequence:CCGGAGCCTGGTATGCTTGACTTTGCTCGAGCAAAGTCAAGCATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-748s21c1
Sequence:CCGGAGATGTATCGGGATATTATACCTCGAGGTATAATATCCCGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-1431s21c1
Sequence:CCGGAGACCACCACAGCAGCTAGACCTCGAGGTCTAGCTGCTGTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.1-773s1c1
Sequence:CCGGCCAGCACTGATAACACTGTCACTCGAGTGACAGTGTTATCAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.1-451s1c1
Sequence:CCGGGCCACAGAAGGAACCTGTAATCTCGAGATTACAGGTTCCTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011868
VALIDATED
ECI2 MISSION shRNA Lentiviral Transduction Particles
enoyl-CoA delta isomerase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.2-909s1c1
Sequence:CCGGGTGTTACTGAGGGACTTTGTACTCGAGTACAAAGTCCCTCAGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-840s21c1
Sequence:CCGGAGTGGGAATGACCTGACTAACCTCGAGGTTAGTCAGGTCATTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-997s21c1
Sequence:CCGGTCACCCTTCTGGGACTATTTGCTCGAGCAAATAGTCCCAGAAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-490s21c1
Sequence:CCGGAGCCTGGTATGCTTGACTTTGCTCGAGCAAAGTCAAGCATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-748s21c1
Sequence:CCGGAGATGTATCGGGATATTATACCTCGAGGTATAATATCCCGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_011868.2-1431s21c1
Sequence:CCGGAGACCACCACAGCAGCTAGACCTCGAGGTCTAGCTGCTGTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.1-773s1c1
Sequence:CCGGCCAGCACTGATAACACTGTCACTCGAGTGACAGTGTTATCAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011868.1-451s1c1
Sequence:CCGGGCCACAGAAGGAACCTGTAATCTCGAGATTACAGGTTCCTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks