EMAIL THIS PAGE TO A FRIEND

ECM1

extracellular matrix protein 1

73 Gene Product Result for
Synonyms: URBWD
Gene ID:
Human(1893) Summary: This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Mouse(13601) extracellular matrix protein 1
Rat(116662) extracellular matrix protein 1
sheep(101105541) extracellular matrix protein 1
Domestic Rabbit(100338579) extracellular matrix protein 1
domestic guinea pig(100721378) extracellular matrix protein 1
naked mole-rat(101723142) extracellular matrix protein 1
chicken(100858704) extracellular matrix protein 1
domestic cat(101089706) extracellular matrix protein 1
cow(524222) extracellular matrix protein 1
Horse(100054714) extracellular matrix protein 1
dog(608791) extracellular matrix protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004425 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156721 MISSION® esiRNA esiRNA human ECM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004425 Rosetta Predictions human pricing
NM_022664 Rosetta Predictions human pricing
NM_053882 Rosetta Predictions rat pricing
NM_007899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074793 predicted 484
2 SASI_Hs01_00074794 predicted 298
3 SASI_Hs02_00337587 predicted 305
4 SASI_Hs01_00074799 predicted 474
5 SASI_Hs01_00074800 predicted 1440
6 SASI_Hs02_00337588 predicted 283
7 SASI_Hs01_00074801 predicted 269
8 SASI_Hs02_00337589 predicted 1522
9 SASI_Hs02_00337590 predicted 513
10 SASI_Hs02_00337591 predicted 1389
11 SASI_Hs01_00074795 predicted 1492
12 SASI_Hs01_00074796 predicted 1591
13 SASI_Hs01_00074797 predicted 1490
14 SASI_Hs01_00074798 predicted 1593
15 SASI_Hs01_00074802 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237499 predicted 480
2 SASI_Hs01_00237500 predicted 303
3 SASI_Hs02_00355934 predicted 305
4 SASI_Hs01_00237505 predicted 478
5 SASI_Hs01_00237506 predicted 1062
6 SASI_Hs02_00355935 predicted 281
7 SASI_Hs01_00237507 predicted 268
8 SASI_Hs02_00355936 predicted 1153
9 SASI_Hs02_00355937 predicted 509
10 SASI_Hs02_00355938 predicted 1017
11 SASI_Hs01_00237501 predicted 1116
12 SASI_Hs01_00237502 predicted 1218
13 SASI_Hs01_00237503 predicted 1115
14 SASI_Hs01_00237504 predicted 1218
15 SASI_Hs01_00237508 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115306 predicted 844
2 SASI_Rn01_00115307 predicted 1552
3 SASI_Rn01_00115308 predicted 1390
4 SASI_Rn01_00115309 predicted 861
5 SASI_Rn01_00115310 predicted 1251
6 SASI_Rn01_00115311 predicted 275
7 SASI_Rn01_00115313 predicted 1458
8 SASI_Rn01_00115314 predicted 796
9 SASI_Rn02_00266789 predicted 1630
10 SASI_Rn01_00115315 predicted 1564
11 SASI_Rn01_00115312 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156151 predicted 1270
2 SASI_Mm01_00156152 predicted 1471
3 SASI_Mm01_00156153 predicted 1373
4 SASI_Mm01_00156154 predicted 1465
5 SASI_Mm02_00312689 predicted 414
6 SASI_Mm01_00156155 predicted 301
7 SASI_Mm01_00156156 predicted 885
8 SASI_Mm01_00156158 predicted 1409
9 SASI_Mm01_00156159 predicted 1374
10 SASI_Mm01_00156160 predicted 1399
11 SASI_Mm01_00156157 predicted 1654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007899
ECM1 MISSION shRNA Bacterial Glycerol Stock
extracellular matrix protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007899.1-240s1c1
Sequence:CCGGGCACCTCCATGAAGTAGGTTACTCGAGTAACCTACTTCATGGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007899.1-1471s1c1
Sequence:CCGGCTTAGCAAGCATAAACAGATTCTCGAGAATCTGTTTATGCTTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-241s1c1
Sequence:CCGGCACCTCCATGAAGTAGGTTATCTCGAGATAACCTACTTCATGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1674s1c1
Sequence:CCGGCAATACCAACTACCTGAGGAACTCGAGTTCCTCAGGTAGTTGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1665s1c1
Sequence:CCGGCAACTGCTTCAATACCAACTACTCGAGTAGTTGGTATTGAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1470s1c1
Sequence:CCGGCCTTAGCAAGCATAAACAGATCTCGAGATCTGTTTATGCTTGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007899
ECM1 MISSION shRNA shRNA Plasmid DNA
extracellular matrix protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007899.1-240s1c1
Sequence:CCGGGCACCTCCATGAAGTAGGTTACTCGAGTAACCTACTTCATGGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007899.1-1471s1c1
Sequence:CCGGCTTAGCAAGCATAAACAGATTCTCGAGAATCTGTTTATGCTTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-241s1c1
Sequence:CCGGCACCTCCATGAAGTAGGTTATCTCGAGATAACCTACTTCATGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1674s1c1
Sequence:CCGGCAATACCAACTACCTGAGGAACTCGAGTTCCTCAGGTAGTTGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1665s1c1
Sequence:CCGGCAACTGCTTCAATACCAACTACTCGAGTAGTTGGTATTGAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1470s1c1
Sequence:CCGGCCTTAGCAAGCATAAACAGATCTCGAGATCTGTTTATGCTTGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007899
ECM1 MISSION shRNA Lentiviral Transduction Particles
extracellular matrix protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007899.1-240s1c1
Sequence:CCGGGCACCTCCATGAAGTAGGTTACTCGAGTAACCTACTTCATGGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007899.1-1471s1c1
Sequence:CCGGCTTAGCAAGCATAAACAGATTCTCGAGAATCTGTTTATGCTTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-241s1c1
Sequence:CCGGCACCTCCATGAAGTAGGTTATCTCGAGATAACCTACTTCATGGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1674s1c1
Sequence:CCGGCAATACCAACTACCTGAGGAACTCGAGTTCCTCAGGTAGTTGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1665s1c1
Sequence:CCGGCAACTGCTTCAATACCAACTACTCGAGTAGTTGGTATTGAAGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007899.1-1470s1c1
Sequence:CCGGCCTTAGCAAGCATAAACAGATCTCGAGATCTGTTTATGCTTGCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004425
ECM1 MISSION shRNA Bacterial Glycerol Stock
extracellular matrix protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-968s1c1
Sequence:CCGGCCTGATATTTCCTCGGGTCTTCTCGAGAAGACCCGAGGAAATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1012s1c1
Sequence:CCGGGCCCACATTGGACAATATCAACTCGAGTTGATATTGTCCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1445s1c1
Sequence:CCGGCGCTGCTGTGACCTGCCATTTCTCGAGAAATGGCAGGTCACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-135s1c1
Sequence:CCGGTGACCTATTTGGCTGTTGCTTCTCGAGAAGCAACAGCCAAATAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1591s1c1
Sequence:CCGGCAACTGCTTCAACATCAATTACTCGAGTAATTGATGTTGAAGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004425.3-831s21c1
Sequence:CCGGATTTCCTGGAGATTGGATATTCTCGAGAATATCCAATCTCCAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004425.3-1488s21c1
Sequence:CCGGGAGTTCTCACCAAGCATAAACCTCGAGGTTTATGCTTGGTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004425.3-1879s21c1
Sequence:CCGGCTGAACACTCATTACACTAAACTCGAGTTTAGTGTAATGAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004425
ECM1 MISSION shRNA shRNA Plasmid DNA
extracellular matrix protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-968s1c1
Sequence:CCGGCCTGATATTTCCTCGGGTCTTCTCGAGAAGACCCGAGGAAATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1012s1c1
Sequence:CCGGGCCCACATTGGACAATATCAACTCGAGTTGATATTGTCCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1445s1c1
Sequence:CCGGCGCTGCTGTGACCTGCCATTTCTCGAGAAATGGCAGGTCACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-135s1c1
Sequence:CCGGTGACCTATTTGGCTGTTGCTTCTCGAGAAGCAACAGCCAAATAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1591s1c1
Sequence:CCGGCAACTGCTTCAACATCAATTACTCGAGTAATTGATGTTGAAGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004425.3-831s21c1
Sequence:CCGGATTTCCTGGAGATTGGATATTCTCGAGAATATCCAATCTCCAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004425.3-1488s21c1
Sequence:CCGGGAGTTCTCACCAAGCATAAACCTCGAGGTTTATGCTTGGTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004425.3-1879s21c1
Sequence:CCGGCTGAACACTCATTACACTAAACTCGAGTTTAGTGTAATGAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004425
ECM1 MISSION shRNA Lentiviral Transduction Particles
extracellular matrix protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-968s1c1
Sequence:CCGGCCTGATATTTCCTCGGGTCTTCTCGAGAAGACCCGAGGAAATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1012s1c1
Sequence:CCGGGCCCACATTGGACAATATCAACTCGAGTTGATATTGTCCAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1445s1c1
Sequence:CCGGCGCTGCTGTGACCTGCCATTTCTCGAGAAATGGCAGGTCACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-135s1c1
Sequence:CCGGTGACCTATTTGGCTGTTGCTTCTCGAGAAGCAACAGCCAAATAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004425.2-1591s1c1
Sequence:CCGGCAACTGCTTCAACATCAATTACTCGAGTAATTGATGTTGAAGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004425.3-831s21c1
Sequence:CCGGATTTCCTGGAGATTGGATATTCTCGAGAATATCCAATCTCCAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004425.3-1488s21c1
Sequence:CCGGGAGTTCTCACCAAGCATAAACCTCGAGGTTTATGCTTGGTGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004425.3-1879s21c1
Sequence:CCGGCTGAACACTCATTACACTAAACTCGAGTTTAGTGTAATGAGTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks