EMAIL THIS PAGE TO A FRIEND

ECM2

extracellular matrix protein 2, female organ and adipocyte specific

49 Gene Product Result for
UniProtKB ID: O94769, B2R730, E2PU11, Q5T9F2, Q7Z3D0
Gene ID:
Human(1842) Summary: ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(407800) extracellular matrix protein 2, female organ and adipocyte specific
Rat(291018) extracellular matrix protein 2, female organ and adipocyte specific
Zebrafish(558224) extracellular matrix protein 2, female organ and adipocyte specific
cow(533916) extracellular matrix protein 2, female organ and adipocyte specific
Horse(100055819) extracellular matrix protein 2, female organ and adipocyte specific
domestic cat(101082446) extracellular matrix protein 2, female organ and adipocyte specific
dog(476361) extracellular matrix protein 2, female organ and adipocyte specific
chicken(415953) extracellular matrix protein 2, female organ and adipocyte specific
naked mole-rat(101697613) extracellular matrix protein 2, female organ and adipocyte specific
domestic guinea pig(100735543) extracellular matrix protein 2, female organ and adipocyte specific
sheep(101108189) extracellular matrix protein 2, female organ and adipocyte specific
Domestic Rabbit(100350542) extracellular matrix protein 2, female organ and adipocyte specific
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073911 MISSION® esiRNA esiRNA human ECM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001393 Rosetta Predictions human pricing
XM_214443 Rosetta Predictions rat pricing
NM_001012324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194733 predicted 2247
2 SASI_Hs01_00194734 predicted 1419
3 SASI_Hs01_00194735 predicted 1446
4 SASI_Hs02_00331760 predicted 1239
5 SASI_Hs01_00194736 predicted 1809
6 SASI_Hs01_00194737 predicted 1517
7 SASI_Hs01_00194738 predicted 379
8 SASI_Hs01_00194739 predicted 1412
9 SASI_Hs01_00194740 predicted 1277
10 SASI_Hs01_00194742 predicted 540
11 SASI_Hs01_00194741 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169632 predicted 799
2 SASI_Rn01_00169633 predicted 297
3 SASI_Rn01_00169634 predicted 884
4 SASI_Rn01_00169635 predicted 775
5 SASI_Rn01_00169636 predicted 926
6 SASI_Rn01_00169637 predicted 236
7 SASI_Rn01_00169638 predicted 786
8 SASI_Rn01_00169639 predicted 285
9 SASI_Rn01_00169640 predicted 899
10 SASI_Rn01_00169641 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287087 predicted 522
2 SASI_Mm01_00053520 predicted 1903
3 SASI_Mm01_00053521 predicted 1408
4 SASI_Mm01_00053522 predicted 1884
5 SASI_Mm01_00053523 predicted 1365
6 SASI_Mm01_00053524 predicted 1818
7 SASI_Mm01_00053525 predicted 454
8 SASI_Mm01_00053526 predicted 1752
9 SASI_Mm01_00053527 predicted 1435
10 SASI_Mm01_00053528 predicted 1961
11 SASI_Mm01_00053529 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001393
ECM2 MISSION shRNA Bacterial Glycerol Stock
extracellular matrix protein 2, female organ and adipocyte specific
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001393.2-615s21c1
Sequence:CCGGCAAAGAGAACCTACCAATTTACTCGAGTAAATTGGTAGGTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001393.2-2637s21c1
Sequence:CCGGATAAGGTCCTGTGCTATAATTCTCGAGAATTATAGCACAGGACCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001393.2-2126s21c1
Sequence:CCGGATACTCAAGTATCGTTCTTAACTCGAGTTAAGAACGATACTTGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-211s1c1
Sequence:CCGGGCACAGATCAAACAGACAGCTCTCGAGAGCTGTCTGTTTGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-701s1c1
Sequence:CCGGGCACTTCAATCTGAGGAGGATCTCGAGATCCTCCTCAGATTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-2003s1c1
Sequence:CCGGCGGAACATTCTTCCAGAAGAACTCGAGTTCTTCTGGAAGAATGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-260s1c1
Sequence:CCGGCCAGTAGCAAGACTTCCTATTCTCGAGAATAGGAAGTCTTGCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-450s1c1
Sequence:CCGGGCTCAGATGGAAGAGTTCTTTCTCGAGAAAGAACTCTTCCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-1889s1c1
Sequence:CCGGGCATATCATTCTCTGAGAGAACTCGAGTTCTCTCAGAGAATGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-1652s1c1
Sequence:CCGGGCTCCTTTAGCCTGGATAAATCTCGAGATTTATCCAGGCTAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-558s1c1
Sequence:CCGGCCTATTCTCTACTCAGTGGTACTCGAGTACCACTGAGTAGAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001393
ECM2 MISSION shRNA shRNA Plasmid DNA
extracellular matrix protein 2, female organ and adipocyte specific
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001393.2-615s21c1
Sequence:CCGGCAAAGAGAACCTACCAATTTACTCGAGTAAATTGGTAGGTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001393.2-2637s21c1
Sequence:CCGGATAAGGTCCTGTGCTATAATTCTCGAGAATTATAGCACAGGACCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001393.2-2126s21c1
Sequence:CCGGATACTCAAGTATCGTTCTTAACTCGAGTTAAGAACGATACTTGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-211s1c1
Sequence:CCGGGCACAGATCAAACAGACAGCTCTCGAGAGCTGTCTGTTTGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-701s1c1
Sequence:CCGGGCACTTCAATCTGAGGAGGATCTCGAGATCCTCCTCAGATTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-2003s1c1
Sequence:CCGGCGGAACATTCTTCCAGAAGAACTCGAGTTCTTCTGGAAGAATGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-260s1c1
Sequence:CCGGCCAGTAGCAAGACTTCCTATTCTCGAGAATAGGAAGTCTTGCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-450s1c1
Sequence:CCGGGCTCAGATGGAAGAGTTCTTTCTCGAGAAAGAACTCTTCCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-1889s1c1
Sequence:CCGGGCATATCATTCTCTGAGAGAACTCGAGTTCTCTCAGAGAATGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-1652s1c1
Sequence:CCGGGCTCCTTTAGCCTGGATAAATCTCGAGATTTATCCAGGCTAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-558s1c1
Sequence:CCGGCCTATTCTCTACTCAGTGGTACTCGAGTACCACTGAGTAGAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001393
ECM2 MISSION shRNA Lentiviral Transduction Particles
extracellular matrix protein 2, female organ and adipocyte specific
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001393.2-615s21c1
Sequence:CCGGCAAAGAGAACCTACCAATTTACTCGAGTAAATTGGTAGGTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001393.2-2637s21c1
Sequence:CCGGATAAGGTCCTGTGCTATAATTCTCGAGAATTATAGCACAGGACCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001393.2-2126s21c1
Sequence:CCGGATACTCAAGTATCGTTCTTAACTCGAGTTAAGAACGATACTTGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-211s1c1
Sequence:CCGGGCACAGATCAAACAGACAGCTCTCGAGAGCTGTCTGTTTGATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-701s1c1
Sequence:CCGGGCACTTCAATCTGAGGAGGATCTCGAGATCCTCCTCAGATTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-2003s1c1
Sequence:CCGGCGGAACATTCTTCCAGAAGAACTCGAGTTCTTCTGGAAGAATGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-260s1c1
Sequence:CCGGCCAGTAGCAAGACTTCCTATTCTCGAGAATAGGAAGTCTTGCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-450s1c1
Sequence:CCGGGCTCAGATGGAAGAGTTCTTTCTCGAGAAAGAACTCTTCCATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-1889s1c1
Sequence:CCGGGCATATCATTCTCTGAGAGAACTCGAGTTCTCTCAGAGAATGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001393.1-1652s1c1
Sequence:CCGGGCTCCTTTAGCCTGGATAAATCTCGAGATTTATCCAGGCTAAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001393.1-558s1c1
Sequence:CCGGCCTATTCTCTACTCAGTGGTACTCGAGTACCACTGAGTAGAGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012324
ECM2 MISSION shRNA Bacterial Glycerol Stock
extracellular matrix protein 2, female organ and adipocyte specific
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012324.2-1890s1c1
Sequence:CCGGGTACTTGTACCTGTCATTTAACTCGAGTTAAATGACAGGTACAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-1036s21c1
Sequence:CCGGAGAATGTCCTCCCGGGTAATTCTCGAGAATTACCCGGGAGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-687s21c1
Sequence:CCGGTGCTGAACAAGAATCCATTAACTCGAGTTAATGGATTCTTGTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012324.2-3314s21c1
Sequence:CCGGTGTCTATGATCTAGCTATTAACTCGAGTTAATAGCTAGATCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-1753s21c1
Sequence:CCGGTCTATTGACCTGTCCTATAACCTCGAGGTTATAGGACAGGTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-2055s21c1
Sequence:CCGGCAACAATAAGATTCGGAATATCTCGAGATATTCCGAATCTTATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012324.1-2417s1c1
Sequence:CCGGCGGCACCTTCTGCCATTTATACTCGAGTATAAATGGCAGAAGGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012324.1-451s1c1
Sequence:CCGGGAATCGCTTCTAAGTAATCTTCTCGAGAAGATTACTTAGAAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012324
ECM2 MISSION shRNA shRNA Plasmid DNA
extracellular matrix protein 2, female organ and adipocyte specific
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012324.2-1890s1c1
Sequence:CCGGGTACTTGTACCTGTCATTTAACTCGAGTTAAATGACAGGTACAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-1036s21c1
Sequence:CCGGAGAATGTCCTCCCGGGTAATTCTCGAGAATTACCCGGGAGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-687s21c1
Sequence:CCGGTGCTGAACAAGAATCCATTAACTCGAGTTAATGGATTCTTGTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012324.2-3314s21c1
Sequence:CCGGTGTCTATGATCTAGCTATTAACTCGAGTTAATAGCTAGATCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-1753s21c1
Sequence:CCGGTCTATTGACCTGTCCTATAACCTCGAGGTTATAGGACAGGTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-2055s21c1
Sequence:CCGGCAACAATAAGATTCGGAATATCTCGAGATATTCCGAATCTTATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012324.1-2417s1c1
Sequence:CCGGCGGCACCTTCTGCCATTTATACTCGAGTATAAATGGCAGAAGGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012324.1-451s1c1
Sequence:CCGGGAATCGCTTCTAAGTAATCTTCTCGAGAAGATTACTTAGAAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012324
ECM2 MISSION shRNA Lentiviral Transduction Particles
extracellular matrix protein 2, female organ and adipocyte specific
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012324.2-1890s1c1
Sequence:CCGGGTACTTGTACCTGTCATTTAACTCGAGTTAAATGACAGGTACAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-1036s21c1
Sequence:CCGGAGAATGTCCTCCCGGGTAATTCTCGAGAATTACCCGGGAGGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-687s21c1
Sequence:CCGGTGCTGAACAAGAATCCATTAACTCGAGTTAATGGATTCTTGTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012324.2-3314s21c1
Sequence:CCGGTGTCTATGATCTAGCTATTAACTCGAGTTAATAGCTAGATCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-1753s21c1
Sequence:CCGGTCTATTGACCTGTCCTATAACCTCGAGGTTATAGGACAGGTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012324.2-2055s21c1
Sequence:CCGGCAACAATAAGATTCGGAATATCTCGAGATATTCCGAATCTTATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012324.1-2417s1c1
Sequence:CCGGCGGCACCTTCTGCCATTTATACTCGAGTATAAATGGCAGAAGGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012324.1-451s1c1
Sequence:CCGGGAATCGCTTCTAAGTAATCTTCTCGAGAAGATTACTTAGAAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks