EMAIL THIS PAGE TO A FRIEND

ECSCR

endothelial cell surface expressed chemotaxis and apoptosis regulator

52 Gene Product Result for
Synonyms: ARIA ECSM2
UniProtKB ID: Q19T08
Gene ID:
Human(641700) Summary: The protein encoded by this gene is primarily found in endothelial cells and blood vessels, where it may be involved in cell shape changes and EGF-induced cell migration. This gene could play a role in angiogenesis-related diseases. [provided by RefSeq, Apr 2010]
Mouse(68545) endothelial cell surface expressed chemotaxis and apoptosis regulator
Rat(689248) endothelial cell surface expressed chemotaxis and apoptosis regulator
Zebrafish(550161) endothelial cell-specific chemotaxis regulator
cow(511765) endothelial cell-specific chemotaxis regulator
domestic cat(101090483) endothelial cell surface expressed chemotaxis and apoptosis regulator
dog(478026) endothelial cell surface expressed chemotaxis and apoptosis regulator
chicken(416190) endothelial cell surface expressed chemotaxis and apoptosis regulator
sheep(101115456) endothelial cell surface expressed chemotaxis and apoptosis regulator
naked mole-rat(101722387) endothelial cell surface expressed chemotaxis and apoptosis regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301827 ANTI-ECSCR (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001077693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077693 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU171551 MISSION® esiRNA esiRNA targeting mouse Ecscr mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077693 Rosetta Predictions human pricing
XM_930608 Rosetta Predictions human pricing
XM_001070120 Rosetta Predictions rat pricing
NM_001033141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313146 predicted 551
2 SASI_Hs02_00313147 predicted 637
3 SASI_Hs02_00313148 predicted 430
4 SASI_Hs02_00313149 predicted 309
5 SASI_Hs02_00313150 predicted 725
6 SASI_Hs02_00313151 predicted 740
7 SASI_Hs02_00313152 predicted 793
8 SASI_Hs02_00313153 predicted 233
9 SASI_Hs02_00313154 predicted 320
10 SASI_Hs02_00313155 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259023 predicted 183
2 SASI_Hs01_00259024 predicted 217
3 SASI_Hs01_00259025 predicted 237
4 SASI_Hs01_00259026 predicted 284
5 SASI_Hs01_00259027 predicted 220
6 SASI_Hs01_00259028 predicted 90
7 SASI_Hs01_00259029 predicted 242
8 SASI_Hs01_00259030 predicted 148
9 SASI_Hs01_00259031 predicted 196
10 SASI_Hs01_00259032 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330504 predicted 378
2 SASI_Rn02_00330505 predicted 285
3 SASI_Rn02_00330506 predicted 434
4 SASI_Rn02_00330507 predicted 449
5 SASI_Rn02_00330508 predicted 455
6 SASI_Rn02_00330509 predicted 403
7 SASI_Rn02_00330510 predicted 441
8 SASI_Rn02_00330511 predicted 347
9 SASI_Rn02_00330512 predicted 293
10 SASI_Rn02_00330513 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075803 predicted 640
2 SASI_Mm01_00075805 predicted 746
3 SASI_Mm02_00288222 predicted 739
4 SASI_Mm01_00075806 predicted 637
5 SASI_Mm01_00075807 predicted 696
6 SASI_Mm01_00075809 predicted 640
7 SASI_Mm02_00288223 predicted 715
8 SASI_Mm01_00075810 predicted 726
9 SASI_Mm01_00075811 predicted 754
10 SASI_Mm02_00288224 predicted 707
11 SASI_Mm01_00075804 predicted 871
12 SASI_Mm01_00075808 predicted 619
13 SASI_Mm01_00075812 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033141
VALIDATED
ECSCR MISSION shRNA Bacterial Glycerol Stock
endothelial cell surface expressed chemotaxis and apoptosis regulator
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033141.1-294s1c1
Sequence:CCGGCCTTTCCTTGCCTGACTTGATCTCGAGATCAAGTCAGGCAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033141.1-610s1c1
Sequence:CCGGCGGAAGAACAAGGAGTCTGAACTCGAGTTCAGACTCCTTGTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-268s21c1
Sequence:CCGGAGGTCAAGCACCATGGATAAACTCGAGTTTATCCATGGTGCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-753s21c1
Sequence:CCGGGTCAGCAGAGAAGATTCTTTACTCGAGTAAAGAATCTTCTCTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-584s21c1
Sequence:CCGGGTGTGGTCAGTCTAAGATTTACTCGAGTAAATCTTAGACTGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-623s21c1
Sequence:CCGGAGTCTGAAGATCCACAGAAACCTCGAGGTTTCTGTGGATCTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-861s21c1
Sequence:CCGGAGCGGACCACACATAAATTATCTCGAGATAATTTATGTGTGGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033141
VALIDATED
ECSCR MISSION shRNA shRNA Plasmid DNA
endothelial cell surface expressed chemotaxis and apoptosis regulator
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033141.1-294s1c1
Sequence:CCGGCCTTTCCTTGCCTGACTTGATCTCGAGATCAAGTCAGGCAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033141.1-610s1c1
Sequence:CCGGCGGAAGAACAAGGAGTCTGAACTCGAGTTCAGACTCCTTGTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-268s21c1
Sequence:CCGGAGGTCAAGCACCATGGATAAACTCGAGTTTATCCATGGTGCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-753s21c1
Sequence:CCGGGTCAGCAGAGAAGATTCTTTACTCGAGTAAAGAATCTTCTCTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-584s21c1
Sequence:CCGGGTGTGGTCAGTCTAAGATTTACTCGAGTAAATCTTAGACTGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-623s21c1
Sequence:CCGGAGTCTGAAGATCCACAGAAACCTCGAGGTTTCTGTGGATCTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-861s21c1
Sequence:CCGGAGCGGACCACACATAAATTATCTCGAGATAATTTATGTGTGGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033141
VALIDATED
ECSCR MISSION shRNA Lentiviral Transduction Particles
endothelial cell surface expressed chemotaxis and apoptosis regulator
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033141.1-294s1c1
Sequence:CCGGCCTTTCCTTGCCTGACTTGATCTCGAGATCAAGTCAGGCAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033141.1-610s1c1
Sequence:CCGGCGGAAGAACAAGGAGTCTGAACTCGAGTTCAGACTCCTTGTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-268s21c1
Sequence:CCGGAGGTCAAGCACCATGGATAAACTCGAGTTTATCCATGGTGCTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-753s21c1
Sequence:CCGGGTCAGCAGAGAAGATTCTTTACTCGAGTAAAGAATCTTCTCTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-584s21c1
Sequence:CCGGGTGTGGTCAGTCTAAGATTTACTCGAGTAAATCTTAGACTGACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-623s21c1
Sequence:CCGGAGTCTGAAGATCCACAGAAACCTCGAGGTTTCTGTGGATCTTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033141.1-861s21c1
Sequence:CCGGAGCGGACCACACATAAATTATCTCGAGATAATTTATGTGTGGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077693
ECSCR MISSION shRNA Bacterial Glycerol Stock
endothelial cell surface expressed chemotaxis and apoptosis regulator
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-662s21c1
Sequence:CCGGCTCAGCAGAGAAGGTTCTTTACTCGAGTAAAGAACCTTCTCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077693.2-763s21c1
Sequence:CCGGAGGCAATGAACCACATGTAAACTCGAGTTTACATGTGGTTCATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-428s21c1
Sequence:CCGGTGTGGCTGCATTTGGTGTTATCTCGAGATAACACCAAATGCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-472s21c1
Sequence:CCGGTTGTGGTGATCATCCTAGTTGCTCGAGCAACTAGGATGATCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-599s21c1
Sequence:CCGGGAAAGACAGCATCACCCTTATCTCGAGATAAGGGTGATGCTGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077693
ECSCR MISSION shRNA shRNA Plasmid DNA
endothelial cell surface expressed chemotaxis and apoptosis regulator
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-662s21c1
Sequence:CCGGCTCAGCAGAGAAGGTTCTTTACTCGAGTAAAGAACCTTCTCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077693.2-763s21c1
Sequence:CCGGAGGCAATGAACCACATGTAAACTCGAGTTTACATGTGGTTCATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-428s21c1
Sequence:CCGGTGTGGCTGCATTTGGTGTTATCTCGAGATAACACCAAATGCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-472s21c1
Sequence:CCGGTTGTGGTGATCATCCTAGTTGCTCGAGCAACTAGGATGATCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-599s21c1
Sequence:CCGGGAAAGACAGCATCACCCTTATCTCGAGATAAGGGTGATGCTGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077693
ECSCR MISSION shRNA Lentiviral Transduction Particles
endothelial cell surface expressed chemotaxis and apoptosis regulator
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-662s21c1
Sequence:CCGGCTCAGCAGAGAAGGTTCTTTACTCGAGTAAAGAACCTTCTCTGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077693.2-763s21c1
Sequence:CCGGAGGCAATGAACCACATGTAAACTCGAGTTTACATGTGGTTCATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-428s21c1
Sequence:CCGGTGTGGCTGCATTTGGTGTTATCTCGAGATAACACCAAATGCAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-472s21c1
Sequence:CCGGTTGTGGTGATCATCCTAGTTGCTCGAGCAACTAGGATGATCACCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077693.2-599s21c1
Sequence:CCGGGAAAGACAGCATCACCCTTATCTCGAGATAAGGGTGATGCTGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks