EMAIL THIS PAGE TO A FRIEND

ECSIT

ECSIT signalling integrator

Synonyms: SITPEC
UniProtKB ID: Q9BQ95, E9PAN9, Q96HQ7, Q9NYI1
Gene ID:
Mouse(26940) ECSIT homolog (Drosophila)
Rat(300447) ECSIT signalling integrator
naked mole-rat(101716127) ECSIT signalling integrator
domestic guinea pig(100726429) ECSIT signalling integrator
sheep(101120161) ECSIT homolog (Drosophila)
Zebrafish(569243) ECSIT homolog (Drosophila)
fruit fly(40732) CG10610 gene product from transcript CG10610-RA
Horse(100054814) ECSIT homolog (Drosophila)
cow(507245) ECSIT homolog (Drosophila)
domestic cat(101099619) ECSIT homolog (Drosophila)
dog(484938) ECSIT homolog (Drosophila)
chicken(100857880) ECSIT homolog (Drosophila)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059841 MISSION® esiRNA esiRNA human ECSIT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016581 Rosetta Predictions human pricing
NM_001006986 Rosetta Predictions rat pricing
NM_012029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154764 predicted 752
2 SASI_Hs01_00154765 predicted 1096
3 SASI_Hs01_00154766 predicted 863
4 SASI_Hs01_00154767 predicted 490
5 SASI_Hs01_00154768 predicted 605
6 SASI_Hs01_00154770 predicted 786
7 SASI_Hs01_00154771 predicted 506
8 SASI_Hs02_00349710 predicted 765
9 SASI_Hs01_00154772 predicted 687
10 SASI_Hs01_00154773 predicted 678
11 SASI_Hs01_00154769 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059109 predicted 963
2 SASI_Rn01_00059111 predicted 952
3 SASI_Rn01_00059113 predicted 784
4 SASI_Rn01_00059114 predicted 567
5 SASI_Rn01_00059115 predicted 794
6 SASI_Rn01_00059116 predicted 745
7 SASI_Rn01_00059117 predicted 1008
8 SASI_Rn01_00059118 predicted 953
9 SASI_Rn02_00198559 predicted 776
10 SASI_Rn02_00198560 predicted 735
11 SASI_Rn01_00059110 predicted 603
12 SASI_Rn01_00059112 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141100 predicted 1077
2 SASI_Mm01_00141101 predicted 828
3 SASI_Mm01_00141102 predicted 1086
4 SASI_Mm01_00141103 predicted 1007
5 SASI_Mm01_00141104 predicted 832
6 SASI_Mm01_00141106 predicted 1237
7 SASI_Mm01_00141107 predicted 365
8 SASI_Mm01_00141108 predicted 1182
9 SASI_Mm01_00141109 predicted 1193
10 SASI_Mm02_00321997 predicted 1395
11 SASI_Mm01_00141105 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016581
VALIDATED
ECSIT MISSION shRNA Bacterial Glycerol Stock
ECSIT signalling integrator
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016581.3-1545s21c1
Sequence:CCGGTCATCTCTAGCAGTATGGCATCTCGAGATGCCATACTGCTAGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-479s21c1
Sequence:CCGGCAAGATGCGGGAGTATGGTGTCTCGAGACACCATACTCCCGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-1238s21c1
Sequence:CCGGGACGATGGCTAAGTGGATCCACTCGAGTGGATCCACTTAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-403s21c1
Sequence:CCGGTGCAGACGGTGCAGAAATTTGCTCGAGCAAATTTCTGCACCGTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-684s21c1
Sequence:CCGGATTCAGATCTTTGGACGCAAACTCGAGTTTGCGTCCAAAGATCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-929s21c1
Sequence:CCGGAGGAATCCAGAGTCCCGATCACTCGAGTGATCGGGACTCTGGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-1436s1c1
Sequence:CCGGGCCCTTTGAGTGTACAGCAAACTCGAGTTTGCTGTACACTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-961s1c1
Sequence:CCGGTCCGCAACAAGTGTGTGTATTCTCGAGAATACACACACTTGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-689s1c1
Sequence:CCGGCCCTCGATTCATGAACGTCAACTCGAGTTGACGTTCATGAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016581.2-962s1c1
Sequence:CCGGCCGCAACAAGTGTGTGTATTACTCGAGTAATACACACACTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016581.2-803s1c1
Sequence:CCGGCACCATCTACCAGGTTCCTTTCTCGAGAAAGGAACCTGGTAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016581
VALIDATED
ECSIT MISSION shRNA shRNA Plasmid DNA
ECSIT signalling integrator
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016581.3-1545s21c1
Sequence:CCGGTCATCTCTAGCAGTATGGCATCTCGAGATGCCATACTGCTAGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-479s21c1
Sequence:CCGGCAAGATGCGGGAGTATGGTGTCTCGAGACACCATACTCCCGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-1238s21c1
Sequence:CCGGGACGATGGCTAAGTGGATCCACTCGAGTGGATCCACTTAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-403s21c1
Sequence:CCGGTGCAGACGGTGCAGAAATTTGCTCGAGCAAATTTCTGCACCGTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-684s21c1
Sequence:CCGGATTCAGATCTTTGGACGCAAACTCGAGTTTGCGTCCAAAGATCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-929s21c1
Sequence:CCGGAGGAATCCAGAGTCCCGATCACTCGAGTGATCGGGACTCTGGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-1436s1c1
Sequence:CCGGGCCCTTTGAGTGTACAGCAAACTCGAGTTTGCTGTACACTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-961s1c1
Sequence:CCGGTCCGCAACAAGTGTGTGTATTCTCGAGAATACACACACTTGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-689s1c1
Sequence:CCGGCCCTCGATTCATGAACGTCAACTCGAGTTGACGTTCATGAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016581.2-962s1c1
Sequence:CCGGCCGCAACAAGTGTGTGTATTACTCGAGTAATACACACACTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016581.2-803s1c1
Sequence:CCGGCACCATCTACCAGGTTCCTTTCTCGAGAAAGGAACCTGGTAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016581
VALIDATED
ECSIT MISSION shRNA Lentiviral Transduction Particles
ECSIT signalling integrator
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016581.3-1545s21c1
Sequence:CCGGTCATCTCTAGCAGTATGGCATCTCGAGATGCCATACTGCTAGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-479s21c1
Sequence:CCGGCAAGATGCGGGAGTATGGTGTCTCGAGACACCATACTCCCGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-1238s21c1
Sequence:CCGGGACGATGGCTAAGTGGATCCACTCGAGTGGATCCACTTAGCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-403s21c1
Sequence:CCGGTGCAGACGGTGCAGAAATTTGCTCGAGCAAATTTCTGCACCGTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-684s21c1
Sequence:CCGGATTCAGATCTTTGGACGCAAACTCGAGTTTGCGTCCAAAGATCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016581.3-929s21c1
Sequence:CCGGAGGAATCCAGAGTCCCGATCACTCGAGTGATCGGGACTCTGGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-1436s1c1
Sequence:CCGGGCCCTTTGAGTGTACAGCAAACTCGAGTTTGCTGTACACTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-961s1c1
Sequence:CCGGTCCGCAACAAGTGTGTGTATTCTCGAGAATACACACACTTGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016581.2-689s1c1
Sequence:CCGGCCCTCGATTCATGAACGTCAACTCGAGTTGACGTTCATGAATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_016581.2-962s1c1
Sequence:CCGGCCGCAACAAGTGTGTGTATTACTCGAGTAATACACACACTTGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016581.2-803s1c1
Sequence:CCGGCACCATCTACCAGGTTCCTTTCTCGAGAAAGGAACCTGGTAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012029
ECSIT MISSION shRNA Bacterial Glycerol Stock
ECSIT signalling integrator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-1182s1c1
Sequence:CCGGGCTTCGTAATAAGTGTGTCTACTCGAGTAGACACACTTATTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-912s1c1
Sequence:CCGGCACCCGATTCAAGAATATCAACTCGAGTTGATATTCTTGAATCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-741s1c1
Sequence:CCGGCCAGCGCATCTTCGTCCACTACTCGAGTAGTGGACGAAGATGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-1196s1c1
Sequence:CCGGGTGTCTACTATCACATCCTAACTCGAGTTAGGATGTGATAGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-669s1c1
Sequence:CCGGGCGGGACTTGTCAGTATACAACTCGAGTTGTATACTGACAAGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012029
ECSIT MISSION shRNA shRNA Plasmid DNA
ECSIT signalling integrator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-1182s1c1
Sequence:CCGGGCTTCGTAATAAGTGTGTCTACTCGAGTAGACACACTTATTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-912s1c1
Sequence:CCGGCACCCGATTCAAGAATATCAACTCGAGTTGATATTCTTGAATCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-741s1c1
Sequence:CCGGCCAGCGCATCTTCGTCCACTACTCGAGTAGTGGACGAAGATGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-1196s1c1
Sequence:CCGGGTGTCTACTATCACATCCTAACTCGAGTTAGGATGTGATAGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-669s1c1
Sequence:CCGGGCGGGACTTGTCAGTATACAACTCGAGTTGTATACTGACAAGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012029
ECSIT MISSION shRNA Lentiviral Transduction Particles
ECSIT signalling integrator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-1182s1c1
Sequence:CCGGGCTTCGTAATAAGTGTGTCTACTCGAGTAGACACACTTATTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-912s1c1
Sequence:CCGGCACCCGATTCAAGAATATCAACTCGAGTTGATATTCTTGAATCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-741s1c1
Sequence:CCGGCCAGCGCATCTTCGTCCACTACTCGAGTAGTGGACGAAGATGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-1196s1c1
Sequence:CCGGGTGTCTACTATCACATCCTAACTCGAGTTAGGATGTGATAGTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012029.1-669s1c1
Sequence:CCGGGCGGGACTTGTCAGTATACAACTCGAGTTGTATACTGACAAGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks