EMAIL THIS PAGE TO A FRIEND

ECT2

epithelial cell transforming sequence 2 oncogene

134 Gene Product Result for
Synonyms: ARHGEF31
UniProtKB ID: Q9H8V3, Q0MT80, Q2M269, Q6U836, Q9NSV8, Q9NVW9
Gene ID:
Human(1894) Summary: The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(13605) ect2 oncogene
Rat(361921) epithelial cell transforming sequence 2 oncogene
Zebrafish(445406) epithelial cell transforming sequence 2 oncogene
Thale Cress(820548) CIPK1 interacting protein ECT2
chicken(424983) epithelial cell transforming sequence 2 oncogene
dog(488172) epithelial cell transforming sequence 2 oncogene
domestic cat(101082592) epithelial cell transforming sequence 2 oncogene
Horse(100057917) epithelial cell transforming sequence 2 oncogene
cow(504746) epithelial cell transforming sequence 2 oncogene
sheep(101113294) epithelial cell transforming sequence 2 oncogene
Domestic Rabbit(100356055) epithelial cell transforming sequence 2 oncogene
domestic guinea pig(100717819) epithelial cell transforming sequence 2 oncogene
naked mole-rat(101704002) epithelial cell transforming sequence 2 oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018098 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037471 MISSION® esiRNA esiRNA human ECT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018098 Rosetta Predictions human pricing
NM_001108547 Rosetta Predictions rat pricing
NM_007900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160978 predicted 496
2 SASI_Hs01_00160979 predicted 2660
3 SASI_Hs01_00160980 predicted 353
4 SASI_Hs01_00160981 predicted 620
5 SASI_Hs02_00351281 predicted 1341
6 SASI_Hs01_00160983 predicted 2301
7 SASI_Hs01_00160984 predicted 1400
8 SASI_Hs01_00160985 predicted 2379
9 SASI_Hs01_00160986 predicted 1940
10 SASI_Hs01_00160987 predicted 466
11 SASI_Hs01_00160982 predicted 2150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239719 predicted 1495
2 SASI_Rn02_00239720 predicted 1541
3 SASI_Rn02_00239721 predicted 1112
4 SASI_Rn02_00239722 predicted 962
5 SASI_Rn02_00239723 predicted 1531
6 SASI_Rn02_00239724 predicted 1351
7 SASI_Rn02_00239725 predicted 1279
8 SASI_Rn02_00239726 predicted 1426
9 SASI_Rn02_00239727 predicted 1418
10 SASI_Rn02_00239728 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046597 predicted 1312
2 SASI_Mm01_00046599 predicted 1908
3 SASI_Mm01_00046600 predicted 1521
4 SASI_Mm02_00312690 predicted 2069
5 SASI_Mm01_00046601 predicted 2635
6 SASI_Mm01_00046602 predicted 1897
7 SASI_Mm01_00046603 predicted 1411
8 SASI_Mm01_00046604 predicted 881
9 SASI_Mm01_00046605 predicted 1722
10 SASI_Mm01_00046606 predicted 653
11 SASI_Mm01_00046598 predicted 1551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018098
VALIDATED
ECT2 MISSION shRNA Bacterial Glycerol Stock
epithelial cell transforming sequence 2 oncogene
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-2538s1c1
Sequence:CCGGCCAGCAATGATAAGCATGTAACTCGAGTTACATGCTTATCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-441s1c1
Sequence:CCGGGCCCGTTGTATTGTACAAGTACTCGAGTACTTGTACAATACAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018098.4-1154s1c1
Sequence:CCGGGCTGAGCATTCCCTTTCCATACTCGAGTATGGAAAGGGAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-683s1c1
Sequence:CCGGCGGAATGAACAGGATTTCTATCTCGAGATAGAAATCCTGTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-1958s1c1
Sequence:CCGGCGGGTTGAAACAATTTCTCTACTCGAGTAGAGAAATTGTTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-1154s21c1
Sequence:CCGGGCTGAGCATTCCCTTTCCATACTCGAGTATGGAAAGGGAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-2538s21c1
Sequence:CCGGCCAGCAATGATAAGCATGTAACTCGAGTTACATGCTTATCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-441s21c1
Sequence:CCGGGCCCGTTGTATTGTACAAGTACTCGAGTACTTGTACAATACAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-1958s21c1
Sequence:CCGGCGGGTTGAAACAATTTCTCTACTCGAGTAGAGAAATTGTTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-683s21c1
Sequence:CCGGCGGAATGAACAGGATTTCTATCTCGAGATAGAAATCCTGTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018098
VALIDATED
ECT2 MISSION shRNA shRNA Plasmid DNA
epithelial cell transforming sequence 2 oncogene
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-2538s1c1
Sequence:CCGGCCAGCAATGATAAGCATGTAACTCGAGTTACATGCTTATCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-441s1c1
Sequence:CCGGGCCCGTTGTATTGTACAAGTACTCGAGTACTTGTACAATACAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018098.4-1154s1c1
Sequence:CCGGGCTGAGCATTCCCTTTCCATACTCGAGTATGGAAAGGGAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-683s1c1
Sequence:CCGGCGGAATGAACAGGATTTCTATCTCGAGATAGAAATCCTGTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-1958s1c1
Sequence:CCGGCGGGTTGAAACAATTTCTCTACTCGAGTAGAGAAATTGTTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-1154s21c1
Sequence:CCGGGCTGAGCATTCCCTTTCCATACTCGAGTATGGAAAGGGAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-2538s21c1
Sequence:CCGGCCAGCAATGATAAGCATGTAACTCGAGTTACATGCTTATCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-441s21c1
Sequence:CCGGGCCCGTTGTATTGTACAAGTACTCGAGTACTTGTACAATACAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-1958s21c1
Sequence:CCGGCGGGTTGAAACAATTTCTCTACTCGAGTAGAGAAATTGTTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-683s21c1
Sequence:CCGGCGGAATGAACAGGATTTCTATCTCGAGATAGAAATCCTGTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018098
VALIDATED
ECT2 MISSION shRNA Lentiviral Transduction Particles
epithelial cell transforming sequence 2 oncogene
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-2538s1c1
Sequence:CCGGCCAGCAATGATAAGCATGTAACTCGAGTTACATGCTTATCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-441s1c1
Sequence:CCGGGCCCGTTGTATTGTACAAGTACTCGAGTACTTGTACAATACAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018098.4-1154s1c1
Sequence:CCGGGCTGAGCATTCCCTTTCCATACTCGAGTATGGAAAGGGAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-683s1c1
Sequence:CCGGCGGAATGAACAGGATTTCTATCTCGAGATAGAAATCCTGTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018098.4-1958s1c1
Sequence:CCGGCGGGTTGAAACAATTTCTCTACTCGAGTAGAGAAATTGTTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-1154s21c1
Sequence:CCGGGCTGAGCATTCCCTTTCCATACTCGAGTATGGAAAGGGAATGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-2538s21c1
Sequence:CCGGCCAGCAATGATAAGCATGTAACTCGAGTTACATGCTTATCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-441s21c1
Sequence:CCGGGCCCGTTGTATTGTACAAGTACTCGAGTACTTGTACAATACAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-1958s21c1
Sequence:CCGGCGGGTTGAAACAATTTCTCTACTCGAGTAGAGAAATTGTTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018098.4-683s21c1
Sequence:CCGGCGGAATGAACAGGATTTCTATCTCGAGATAGAAATCCTGTTCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007900
VALIDATED
ECT2 MISSION shRNA Bacterial Glycerol Stock
epithelial cell transforming sequence 2 oncogene
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.1-1041s1c1
Sequence:CCGGCGTGCAGGAGAGACTATGTATCTCGAGATACATAGTCTCTCCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-2126s1c1
Sequence:CCGGGCACAAGGTTATTGGCACTTTCTCGAGAAAGTGCCAATAACCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-1987s1c1
Sequence:CCGGGCCCAGCTAATCTCTTATCTTCTCGAGAAGATAAGAGATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-1646s1c1
Sequence:CCGGCCCTCCGTTTGTAAACTTCTTCTCGAGAAGAAGTTTACAAACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-777s1c1
Sequence:CCGGGCAGTTGATGACTTTAGAAATCTCGAGATTTCTAAAGTCATCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007900.1-3106s1c1
Sequence:CCGGGCAATGCAACACTTGCTGAATCTCGAGATTCAGCAAGTGTTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-2120s21c1
Sequence:CCGGGAAAGCGGCACAAGGTTATTGCTCGAGCAATAACCTTGTGCCGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1729s1c1
Sequence:CCGGCTCAAGATAAATCAAGCTAAACTCGAGTTTAGCTTGATTTATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1420s1c1
Sequence:CCGGGCCACAATCATTCAATTATTTCTCGAGAAATAATTGAATGATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1674s1c1
Sequence:CCGGGAGCAAGGAAATGATCATTAACTCGAGTTAATGATCATTTCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-922s1c1
Sequence:CCGGGAAAGGTGCACTCACCTTATTCTCGAGAATAAGGTGAGTGCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-3164s21c1
Sequence:CCGGTCGATTGTTTGATGTACTTAACTCGAGTTAAGTACATCAAACAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007900.2-1673s21c1
Sequence:CCGGTGAGCAAGGAAATGATCATTACTCGAGTAATGATCATTTCCTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-1388s21c1
Sequence:CCGGACCAGACTGAGAGCAATTATGCTCGAGCATAATTGCTCTCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-778s21c1
Sequence:CCGGGCAGTTGATGACTTTAGAAATCTCGAGATTTCTAAAGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007900
VALIDATED
ECT2 MISSION shRNA shRNA Plasmid DNA
epithelial cell transforming sequence 2 oncogene
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.1-1041s1c1
Sequence:CCGGCGTGCAGGAGAGACTATGTATCTCGAGATACATAGTCTCTCCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-2126s1c1
Sequence:CCGGGCACAAGGTTATTGGCACTTTCTCGAGAAAGTGCCAATAACCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-1987s1c1
Sequence:CCGGGCCCAGCTAATCTCTTATCTTCTCGAGAAGATAAGAGATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-1646s1c1
Sequence:CCGGCCCTCCGTTTGTAAACTTCTTCTCGAGAAGAAGTTTACAAACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-777s1c1
Sequence:CCGGGCAGTTGATGACTTTAGAAATCTCGAGATTTCTAAAGTCATCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007900.1-3106s1c1
Sequence:CCGGGCAATGCAACACTTGCTGAATCTCGAGATTCAGCAAGTGTTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-2120s21c1
Sequence:CCGGGAAAGCGGCACAAGGTTATTGCTCGAGCAATAACCTTGTGCCGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1729s1c1
Sequence:CCGGCTCAAGATAAATCAAGCTAAACTCGAGTTTAGCTTGATTTATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1420s1c1
Sequence:CCGGGCCACAATCATTCAATTATTTCTCGAGAAATAATTGAATGATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1674s1c1
Sequence:CCGGGAGCAAGGAAATGATCATTAACTCGAGTTAATGATCATTTCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-922s1c1
Sequence:CCGGGAAAGGTGCACTCACCTTATTCTCGAGAATAAGGTGAGTGCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-3164s21c1
Sequence:CCGGTCGATTGTTTGATGTACTTAACTCGAGTTAAGTACATCAAACAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007900.2-1673s21c1
Sequence:CCGGTGAGCAAGGAAATGATCATTACTCGAGTAATGATCATTTCCTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-1388s21c1
Sequence:CCGGACCAGACTGAGAGCAATTATGCTCGAGCATAATTGCTCTCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-778s21c1
Sequence:CCGGGCAGTTGATGACTTTAGAAATCTCGAGATTTCTAAAGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007900
VALIDATED
ECT2 MISSION shRNA Lentiviral Transduction Particles
epithelial cell transforming sequence 2 oncogene
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.1-1041s1c1
Sequence:CCGGCGTGCAGGAGAGACTATGTATCTCGAGATACATAGTCTCTCCTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-2126s1c1
Sequence:CCGGGCACAAGGTTATTGGCACTTTCTCGAGAAAGTGCCAATAACCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-1987s1c1
Sequence:CCGGGCCCAGCTAATCTCTTATCTTCTCGAGAAGATAAGAGATTAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-1646s1c1
Sequence:CCGGCCCTCCGTTTGTAAACTTCTTCTCGAGAAGAAGTTTACAAACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007900.1-777s1c1
Sequence:CCGGGCAGTTGATGACTTTAGAAATCTCGAGATTTCTAAAGTCATCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007900.1-3106s1c1
Sequence:CCGGGCAATGCAACACTTGCTGAATCTCGAGATTCAGCAAGTGTTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-2120s21c1
Sequence:CCGGGAAAGCGGCACAAGGTTATTGCTCGAGCAATAACCTTGTGCCGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1729s1c1
Sequence:CCGGCTCAAGATAAATCAAGCTAAACTCGAGTTTAGCTTGATTTATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1420s1c1
Sequence:CCGGGCCACAATCATTCAATTATTTCTCGAGAAATAATTGAATGATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-1674s1c1
Sequence:CCGGGAGCAAGGAAATGATCATTAACTCGAGTTAATGATCATTTCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007900.2-922s1c1
Sequence:CCGGGAAAGGTGCACTCACCTTATTCTCGAGAATAAGGTGAGTGCACCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-3164s21c1
Sequence:CCGGTCGATTGTTTGATGTACTTAACTCGAGTTAAGTACATCAAACAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007900.2-1673s21c1
Sequence:CCGGTGAGCAAGGAAATGATCATTACTCGAGTAATGATCATTTCCTTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-1388s21c1
Sequence:CCGGACCAGACTGAGAGCAATTATGCTCGAGCATAATTGCTCTCAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007900.2-778s21c1
Sequence:CCGGGCAGTTGATGACTTTAGAAATCTCGAGATTTCTAAAGTCATCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks