EMAIL THIS PAGE TO A FRIEND

ECT2L

epithelial cell transforming sequence 2 oncogene-like

Synonyms: ARHGEF32 C6orf91 FBXO49 LFDH dJ509I19.2 dJ509I19.3 dJ509I19.5
UniProtKB ID: Q008S8, B2RUV6, Q5JWK2, Q5JWK3, Q5JWK4
Gene ID:
Mouse(100045792) epithelial cell transforming sequence 2 oncogene-like
Rat(100361997) epithelial cell transforming sequence 2 oncogene-like
naked mole-rat(101702737) epithelial cell transforming sequence 2 oncogene-like
domestic guinea pig(100713816) epithelial cell transforming sequence 2 oncogene-like
sheep(101114710) epithelial cell transforming sequence 2 oncogene-like
Domestic Rabbit(100345342) epithelial cell transforming sequence 2 oncogene-like
Zebrafish(100332935) epithelial cell transforming sequence 2 oncogene-like
dog(100686116) epithelial cell transforming sequence 2 oncogene-like
cow(100141063) epithelial cell transforming sequence 2 oncogene-like
Horse(100067883) epithelial cell transforming sequence 2 oncogene-like
domestic cat(101084712) epithelial cell transforming sequence 2 oncogene-like
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103781 MISSION® esiRNA esiRNA human C6orf91 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077706 Rosetta Predictions human pricing
XM_294019 Rosetta Predictions human pricing
XM_001474944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313216 predicted 2582
2 SASI_Hs02_00313217 predicted 462
3 SASI_Hs02_00313218 predicted 1818
4 SASI_Hs02_00313219 predicted 1809
5 SASI_Hs02_00313220 predicted 1922
6 SASI_Hs02_00313221 predicted 992
7 SASI_Hs02_00313222 predicted 2166
8 SASI_Hs02_00313223 predicted 1330
9 SASI_Hs02_00313224 predicted 1651
10 SASI_Hs02_00313225 predicted 1865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300317 predicted 1360
2 SASI_Hs01_00300318 predicted 2332
3 SASI_Hs01_00300319 predicted 1305
4 SASI_Hs01_00300320 predicted 1672
5 SASI_Hs01_00300321 predicted 708
6 SASI_Hs01_00300322 predicted 2265
7 SASI_Hs01_00300323 predicted 1914
8 SASI_Hs01_00300324 predicted 1042
9 SASI_Hs01_00300325 predicted 2129
10 SASI_Hs01_00300326 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00379000 predicted 1466
2 SASI_Mm02_00379001 predicted 2020
3 SASI_Mm02_00379002 predicted 2354
4 SASI_Mm02_00379003 predicted 2280
5 SASI_Mm02_00379004 predicted 1406
6 SASI_Mm02_00379005 predicted 2104
7 SASI_Mm02_00379006 predicted 1634
8 SASI_Mm02_00379007 predicted 947
9 SASI_Mm02_00379008 predicted 879
10 SASI_Mm02_00379009 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077706
ECT2L MISSION shRNA Bacterial Glycerol Stock
epithelial cell transforming sequence 2 oncogene-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077706.1-3635s21c1
Sequence:CCGGTACTCCTCTAGAGAGCATTAACTCGAGTTAATGCTCTCTAGAGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-688s21c1
Sequence:CCGGACTACGTAAGAAGGAGTTATTCTCGAGAATAACTCCTTCTTACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-349s21c1
Sequence:CCGGACGCTTCATTTCTCTATATATCTCGAGATATATAGAGAAATGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-1114s21c1
Sequence:CCGGGGCACAGAGCATCGGAATATTCTCGAGAATATTCCGATGCTCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-2222s21c1
Sequence:CCGGCTGTACCCATCCCGAAGATTTCTCGAGAAATCTTCGGGATGGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077706
ECT2L MISSION shRNA shRNA Plasmid DNA
epithelial cell transforming sequence 2 oncogene-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077706.1-3635s21c1
Sequence:CCGGTACTCCTCTAGAGAGCATTAACTCGAGTTAATGCTCTCTAGAGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-688s21c1
Sequence:CCGGACTACGTAAGAAGGAGTTATTCTCGAGAATAACTCCTTCTTACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-349s21c1
Sequence:CCGGACGCTTCATTTCTCTATATATCTCGAGATATATAGAGAAATGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-1114s21c1
Sequence:CCGGGGCACAGAGCATCGGAATATTCTCGAGAATATTCCGATGCTCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-2222s21c1
Sequence:CCGGCTGTACCCATCCCGAAGATTTCTCGAGAAATCTTCGGGATGGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077706
ECT2L MISSION shRNA Lentiviral Transduction Particles
epithelial cell transforming sequence 2 oncogene-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077706.1-3635s21c1
Sequence:CCGGTACTCCTCTAGAGAGCATTAACTCGAGTTAATGCTCTCTAGAGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-688s21c1
Sequence:CCGGACTACGTAAGAAGGAGTTATTCTCGAGAATAACTCCTTCTTACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-349s21c1
Sequence:CCGGACGCTTCATTTCTCTATATATCTCGAGATATATAGAGAAATGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-1114s21c1
Sequence:CCGGGGCACAGAGCATCGGAATATTCTCGAGAATATTCCGATGCTCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077706.1-2222s21c1
Sequence:CCGGCTGTACCCATCCCGAAGATTTCTCGAGAAATCTTCGGGATGGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks