EMAIL THIS PAGE TO A FRIEND

EDA2R

ectodysplasin A2 receptor

231 Gene Product Result for
Synonyms: EDA-A2R EDAA2R TNFRSF27 XEDAR
UniProtKB ID: Q9HAV5, Q5VYX9, Q5VYY0, Q6UWM2, Q8IZA6
Gene ID:
Human(60401) Summary: EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that are encoded by the anhidrotic ectodermal dysplasia (EDA) gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. The protein encoded by this gene specifically binds to EDA-A2 isoform. This protein is a type III transmembrane protein of the TNFR (tumor necrosis factor receptor) superfamily, and contains 3 cysteine-rich repeats and a single transmembrane domain but lacks an N-terminal signal peptide. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, May 2011]
Mouse(245527) ectodysplasin A2 receptor
Rat(296872) ectodysplasin A2 receptor
chicken(422166) ectodysplasin A2 receptor
cow(100301324) ectodysplasin A2 receptor
domestic cat(101084857) ectodysplasin A2 receptor
naked mole-rat(101710101) ectodysplasin A2 receptor
domestic guinea pig(100713249) ectodysplasin A2 receptor
sheep(101118670) ectodysplasin A2 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021783 Rosetta Predictions human pricing
XM_001068241 Rosetta Predictions rat pricing
XM_231469 Rosetta Predictions rat pricing
NM_175540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141389 predicted 1004
2 SASI_Hs01_00141390 predicted 990
3 SASI_Hs02_00355091 predicted 951
4 SASI_Hs01_00141392 predicted 640
5 SASI_Hs01_00141393 predicted 1048
6 SASI_Hs01_00141394 predicted 889
7 SASI_Hs01_00141395 predicted 596
8 SASI_Hs01_00141396 predicted 1049
9 SASI_Hs01_00141397 predicted 1004
10 SASI_Hs02_00355092 predicted 271
11 SASI_Hs01_00141388 predicted 889
12 SASI_Hs01_00141391 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323917 predicted 494
2 SASI_Rn02_00323918 predicted 384
3 SASI_Rn02_00323919 predicted 411
4 SASI_Rn02_00323920 predicted 218
5 SASI_Rn02_00323921 predicted 355
6 SASI_Rn02_00323922 predicted 500
7 SASI_Rn02_00323923 predicted 508
8 SASI_Rn02_00323924 predicted 605
9 SASI_Rn02_00323925 predicted 592
10 SASI_Rn02_00323926 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386811 predicted 494
2 SASI_Rn02_00386812 predicted 379
3 SASI_Rn02_00386813 predicted 411
4 SASI_Rn02_00386814 predicted 225
5 SASI_Rn02_00386815 predicted 348
6 SASI_Rn02_00386816 predicted 499
7 SASI_Rn02_00386817 predicted 515
8 SASI_Rn02_00386818 predicted 604
9 SASI_Rn02_00386819 predicted 592
10 SASI_Rn02_00386820 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039785 predicted 786
2 SASI_Mm01_00039786 predicted 255
3 SASI_Mm01_00039787 predicted 1118
4 SASI_Mm01_00039788 predicted 585
5 SASI_Mm01_00039789 predicted 411
6 SASI_Mm01_00039790 predicted 1077
7 SASI_Mm01_00039791 predicted 398
8 SASI_Mm01_00039792 predicted 233
9 SASI_Mm01_00039793 predicted 816
10 SASI_Mm01_00039794 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021783
EDA2R MISSION shRNA Bacterial Glycerol Stock
ectodysplasin A2 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-488s1c1
Sequence:CCGGCCTCTACTGCAAGCAGTTCTTCTCGAGAAGAACTGCTTGCAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-618s1c1
Sequence:CCGGCAAGTGAGTGAGAACATCTTTCTCGAGAAAGATGTTCTCACTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-201s1c1
Sequence:CCGGTGTGCTGTCATCAATCGTGTTCTCGAGAACACGATTGATGACAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-89s1c1
Sequence:CCGGGCTATCCAAGGATTGTGGTTACTCGAGTAACCACAATCCTTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-537s1c1
Sequence:CCGGCTGCAGTTTGAGGCTGATAAACTCGAGTTTATCAGCCTCAAACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021783.2-442s21c1
Sequence:CCGGGCAGCCTGCTAGTGGTGTTTACTCGAGTAAACACCACTAGCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021783.2-1001s21c1
Sequence:CCGGGATGTCCACAAGAGCTAATACCTCGAGGTATTAGCTCTTGTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021783.2-892s21c1
Sequence:CCGGTTCCCAGCCCTTAACTCTAATCTCGAGATTAGAGTTAAGGGCTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021783
EDA2R MISSION shRNA shRNA Plasmid DNA
ectodysplasin A2 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-488s1c1
Sequence:CCGGCCTCTACTGCAAGCAGTTCTTCTCGAGAAGAACTGCTTGCAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-618s1c1
Sequence:CCGGCAAGTGAGTGAGAACATCTTTCTCGAGAAAGATGTTCTCACTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-201s1c1
Sequence:CCGGTGTGCTGTCATCAATCGTGTTCTCGAGAACACGATTGATGACAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-89s1c1
Sequence:CCGGGCTATCCAAGGATTGTGGTTACTCGAGTAACCACAATCCTTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-537s1c1
Sequence:CCGGCTGCAGTTTGAGGCTGATAAACTCGAGTTTATCAGCCTCAAACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021783.2-442s21c1
Sequence:CCGGGCAGCCTGCTAGTGGTGTTTACTCGAGTAAACACCACTAGCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021783.2-1001s21c1
Sequence:CCGGGATGTCCACAAGAGCTAATACCTCGAGGTATTAGCTCTTGTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021783.2-892s21c1
Sequence:CCGGTTCCCAGCCCTTAACTCTAATCTCGAGATTAGAGTTAAGGGCTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021783
EDA2R MISSION shRNA Lentiviral Transduction Particles
ectodysplasin A2 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-488s1c1
Sequence:CCGGCCTCTACTGCAAGCAGTTCTTCTCGAGAAGAACTGCTTGCAGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-618s1c1
Sequence:CCGGCAAGTGAGTGAGAACATCTTTCTCGAGAAAGATGTTCTCACTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-201s1c1
Sequence:CCGGTGTGCTGTCATCAATCGTGTTCTCGAGAACACGATTGATGACAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-89s1c1
Sequence:CCGGGCTATCCAAGGATTGTGGTTACTCGAGTAACCACAATCCTTGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021783.2-537s1c1
Sequence:CCGGCTGCAGTTTGAGGCTGATAAACTCGAGTTTATCAGCCTCAAACTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021783.2-442s21c1
Sequence:CCGGGCAGCCTGCTAGTGGTGTTTACTCGAGTAAACACCACTAGCAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021783.2-1001s21c1
Sequence:CCGGGATGTCCACAAGAGCTAATACCTCGAGGTATTAGCTCTTGTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021783.2-892s21c1
Sequence:CCGGTTCCCAGCCCTTAACTCTAATCTCGAGATTAGAGTTAAGGGCTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175540
VALIDATED
EDA2R MISSION shRNA Bacterial Glycerol Stock
ectodysplasin A2 receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-705s1c1
Sequence:CCGGCGTTGCAATATGAGGCTGAAACTCGAGTTTCAGCCTCATATTGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175540.3-775s1c1
Sequence:CCGGCAGTCCTGAATTTCCAGCTAACTCGAGTTAGCTGGAAATTCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-260s1c1
Sequence:CCGGCTCTCGAAGGATTGTGGTTATCTCGAGATAACCACAATCCTTCGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-1036s1c1
Sequence:CCGGGCTGGAGCTCTATGTACCTTTCTCGAGAAAGGTACATAGAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-399s1c1
Sequence:CCGGCCAACTGCACAAATACCTCTACTCGAGTAGAGGTATTTGTGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175540
VALIDATED
EDA2R MISSION shRNA shRNA Plasmid DNA
ectodysplasin A2 receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-705s1c1
Sequence:CCGGCGTTGCAATATGAGGCTGAAACTCGAGTTTCAGCCTCATATTGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175540.3-775s1c1
Sequence:CCGGCAGTCCTGAATTTCCAGCTAACTCGAGTTAGCTGGAAATTCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-260s1c1
Sequence:CCGGCTCTCGAAGGATTGTGGTTATCTCGAGATAACCACAATCCTTCGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-1036s1c1
Sequence:CCGGGCTGGAGCTCTATGTACCTTTCTCGAGAAAGGTACATAGAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-399s1c1
Sequence:CCGGCCAACTGCACAAATACCTCTACTCGAGTAGAGGTATTTGTGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175540
VALIDATED
EDA2R MISSION shRNA Lentiviral Transduction Particles
ectodysplasin A2 receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-705s1c1
Sequence:CCGGCGTTGCAATATGAGGCTGAAACTCGAGTTTCAGCCTCATATTGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175540.3-775s1c1
Sequence:CCGGCAGTCCTGAATTTCCAGCTAACTCGAGTTAGCTGGAAATTCAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-260s1c1
Sequence:CCGGCTCTCGAAGGATTGTGGTTATCTCGAGATAACCACAATCCTTCGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-1036s1c1
Sequence:CCGGGCTGGAGCTCTATGTACCTTTCTCGAGAAAGGTACATAGAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175540.3-399s1c1
Sequence:CCGGCCAACTGCACAAATACCTCTACTCGAGTAGAGGTATTTGTGCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks