EMAIL THIS PAGE TO A FRIEND

EDA

ectodysplasin A

332 Gene Product Result for
Synonyms: ECTD1 ED1 ED1-A1 ED1-A2 EDA-A1 EDA-A2 EDA1 EDA2 HED HED1 ODT1 STHAGX1 XHED XLHED
Gene ID:
Human(1896) Summary: The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13607) ectodysplasin-A
Rat(302424) ectodysplasin-A
Zebrafish(798740) ectodysplasin A
cow(616179) ectodysplasin A
dog(491935) ectodysplasin A
chicken(769069) ectodysplasin A
sheep(101120990) ectodysplasin A
naked mole-rat(101702209) ectodysplasin A
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU011691 MISSION® esiRNA esiRNA targeting mouse Eda (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005609 Rosetta Predictions human pricing
NM_001005610 Rosetta Predictions human pricing
NM_001005611 Rosetta Predictions human pricing
NM_001005612 Rosetta Predictions human pricing
NM_001005613 Rosetta Predictions human pricing
NM_001005614 Rosetta Predictions human pricing
NM_001005615 Rosetta Predictions human pricing
NM_001399 Rosetta Predictions human pricing
XM_001058423 Rosetta Predictions rat pricing
XM_228582 Rosetta Predictions rat pricing
NM_010099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190817 predicted 408
2 SASI_Hs01_00190818 predicted 408
3 SASI_Hs01_00190819 predicted 336
4 SASI_Hs01_00190820 predicted 382
5 SASI_Hs01_00190821 predicted 268
6 SASI_Hs01_00190816 predicted 351
7 SASI_Hs01_00190822 predicted 397
8 SASI_Hs01_00190823 predicted 1253
9 SASI_Hs01_00190824 predicted 1305
10 SASI_Hs01_00190825 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065001 predicted 400
2 SASI_Hs01_00065002 predicted 407
3 SASI_Hs01_00065003 predicted 336
4 SASI_Hs01_00065004 predicted 382
5 SASI_Hs01_00065005 predicted 260
6 SASI_Hs01_00065000 predicted 356
7 SASI_Hs01_00065006 predicted 396
8 SASI_Hs01_00065008 predicted 688
9 SASI_Hs01_00065009 predicted 729
10 SASI_Hs02_00304992 predicted 741
11 SASI_Hs01_00065007 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137775 predicted 401
2 SASI_Hs01_00137776 predicted 402
3 SASI_Hs01_00137777 predicted 333
4 SASI_Hs01_00137778 predicted 383
5 SASI_Hs01_00137779 predicted 264
6 SASI_Hs01_00137774 predicted 356
7 SASI_Hs01_00137780 predicted 399
8 SASI_Hs01_00137783 predicted 1178
9 SASI_Hs02_00304993 predicted 1005
10 SASI_Hs02_00304994 predicted 1051
11 SASI_Hs01_00137781 predicted 726
12 SASI_Hs01_00137782 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082968 predicted 406
2 SASI_Hs01_00082969 predicted 407
3 SASI_Hs01_00082970 predicted 333
4 SASI_Hs01_00082971 predicted 379
5 SASI_Hs01_00082972 predicted 263
6 SASI_Hs01_00082967 predicted 355
7 SASI_Hs01_00082973 predicted 396
8 SASI_Hs01_00082974 predicted 679
9 SASI_Hs01_00082975 predicted 661
10 SASI_Hs02_00304995 predicted 674
11 SASI_Hs01_00082976 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044455 predicted 360
2 SASI_Hs01_00044456 predicted 415
3 SASI_Hs01_00044457 predicted 408
4 SASI_Hs01_00044458 predicted 336
5 SASI_Hs01_00044459 predicted 387
6 SASI_Hs01_00044460 predicted 268
7 SASI_Hs01_00044461 predicted 404
8 SASI_Hs01_00044462 predicted 891
9 SASI_Hs01_00044463 predicted 887
10 SASI_Hs01_00044464 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214538 predicted 366
2 SASI_Hs01_00214539 predicted 405
3 SASI_Hs01_00214540 predicted 410
4 SASI_Hs01_00214541 predicted 334
5 SASI_Hs01_00214542 predicted 382
6 SASI_Hs01_00214543 predicted 266
7 SASI_Hs01_00214544 predicted 401
8 SASI_Hs01_00214545 predicted 1146
9 SASI_Hs01_00214546 predicted 1075
10 SASI_Hs01_00214547 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162387 predicted 409
2 SASI_Hs01_00162388 predicted 402
3 SASI_Hs01_00162389 predicted 335
4 SASI_Hs01_00162390 predicted 383
5 SASI_Hs01_00162391 predicted 259
6 SASI_Hs01_00162386 predicted 351
7 SASI_Hs01_00162392 predicted 399
8 SASI_Hs01_00162393 predicted 794
9 SASI_Hs01_00162395 predicted 555
10 SASI_Hs02_00304996 predicted 427
11 SASI_Hs01_00162394 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120603 predicted 408
2 SASI_Hs01_00120604 predicted 411
3 SASI_Hs01_00120605 predicted 332
4 SASI_Hs01_00120606 predicted 378
5 SASI_Hs01_00120607 predicted 261
6 SASI_Hs01_00120602 predicted 352
7 SASI_Hs01_00120608 predicted 402
8 SASI_Hs01_00120609 predicted 1254
9 SASI_Hs01_00120610 predicted 1310
10 SASI_Hs01_00120611 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289673 predicted 1451
2 SASI_Rn02_00289674 predicted 1629
3 SASI_Rn02_00289675 predicted 1662
4 SASI_Rn02_00289676 predicted 1603
5 SASI_Rn02_00289677 predicted 1805
6 SASI_Rn02_00289678 predicted 1185
7 SASI_Rn02_00289679 predicted 1838
8 SASI_Rn02_00289680 predicted 1500
9 SASI_Rn02_00289681 predicted 1518
10 SASI_Rn02_00289682 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385250 predicted 1455
2 SASI_Rn02_00385251 predicted 923
3 SASI_Rn02_00385252 predicted 670
4 SASI_Rn02_00385253 predicted 1172
5 SASI_Rn02_00385254 predicted 566
6 SASI_Rn02_00385255 predicted 1436
7 SASI_Rn02_00385256 predicted 375
8 SASI_Rn02_00385257 predicted 1391
9 SASI_Rn02_00385258 predicted 358
10 SASI_Rn02_00385259 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317801 predicted 1509
2 SASI_Mm01_00063225 predicted 961
3 SASI_Mm01_00063226 predicted 1073
4 SASI_Mm01_00063228 predicted 1191
5 SASI_Mm01_00063230 predicted 1075
6 SASI_Mm02_00317802 predicted 786
7 SASI_Mm01_00063231 predicted 1505
8 SASI_Mm01_00063232 predicted 1197
9 SASI_Mm01_00063233 predicted 1343
10 SASI_Mm01_00063234 predicted 1199
11 SASI_Mm01_00063227 predicted 1005
12 SASI_Mm01_00063229 predicted 1434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005609
EDA MISSION shRNA Bacterial Glycerol Stock
ectodysplasin A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-1135s21c1
Sequence:CCGGACGGCACCTACTTCATCTATACTCGAGTATAGATGAAGTAGGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-1059s21c1
Sequence:CCGGGACTGGTCTCGCATCACTATGCTCGAGCATAGTGATGCGAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-735s21c1
Sequence:CCGGGGAGCAGATGGCCCAGTTAAACTCGAGTTTAACTGGGCCATCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1334s1c1
Sequence:CCGGCGCTGACATCTCCATCAACATCTCGAGATGTTGATGGAGATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1083s1c1
Sequence:CCGGCCCAAGGTGTTTAAGCTACATCTCGAGATGTAGCTTAAACACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1017s1c1
Sequence:CCGGGCAATTCAAGTCAAGAATGATCTCGAGATCATTCTTGACTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005609.1-3695s1c1
Sequence:CCGGCCACAGAACTTGTGGCCTTTACTCGAGTAAAGGCCACAAGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-363s1c1
Sequence:CCGGCTGCTCTTCCTGGGTTTCTTTCTCGAGAAAGAAACCCAGGAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005609
EDA MISSION shRNA shRNA Plasmid DNA
ectodysplasin A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-1135s21c1
Sequence:CCGGACGGCACCTACTTCATCTATACTCGAGTATAGATGAAGTAGGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-1059s21c1
Sequence:CCGGGACTGGTCTCGCATCACTATGCTCGAGCATAGTGATGCGAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-735s21c1
Sequence:CCGGGGAGCAGATGGCCCAGTTAAACTCGAGTTTAACTGGGCCATCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1334s1c1
Sequence:CCGGCGCTGACATCTCCATCAACATCTCGAGATGTTGATGGAGATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1083s1c1
Sequence:CCGGCCCAAGGTGTTTAAGCTACATCTCGAGATGTAGCTTAAACACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1017s1c1
Sequence:CCGGGCAATTCAAGTCAAGAATGATCTCGAGATCATTCTTGACTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005609.1-3695s1c1
Sequence:CCGGCCACAGAACTTGTGGCCTTTACTCGAGTAAAGGCCACAAGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-363s1c1
Sequence:CCGGCTGCTCTTCCTGGGTTTCTTTCTCGAGAAAGAAACCCAGGAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005609
EDA MISSION shRNA Lentiviral Transduction Particles
ectodysplasin A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-1135s21c1
Sequence:CCGGACGGCACCTACTTCATCTATACTCGAGTATAGATGAAGTAGGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-1059s21c1
Sequence:CCGGGACTGGTCTCGCATCACTATGCTCGAGCATAGTGATGCGAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005609.1-735s21c1
Sequence:CCGGGGAGCAGATGGCCCAGTTAAACTCGAGTTTAACTGGGCCATCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1334s1c1
Sequence:CCGGCGCTGACATCTCCATCAACATCTCGAGATGTTGATGGAGATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1083s1c1
Sequence:CCGGCCCAAGGTGTTTAAGCTACATCTCGAGATGTAGCTTAAACACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-1017s1c1
Sequence:CCGGGCAATTCAAGTCAAGAATGATCTCGAGATCATTCTTGACTTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005609.1-3695s1c1
Sequence:CCGGCCACAGAACTTGTGGCCTTTACTCGAGTAAAGGCCACAAGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005609.1-363s1c1
Sequence:CCGGCTGCTCTTCCTGGGTTTCTTTCTCGAGAAAGAAACCCAGGAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010099
EDA MISSION shRNA Bacterial Glycerol Stock
ectodysplasin A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010099.2-1008s21c1
Sequence:CCGGCTATGAACCCTAAGGTGTTTACTCGAGTAAACACCTTAGGGTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010099.2-1763s21c1
Sequence:CCGGTGCCATTAGGTTGCAACTTAACTCGAGTTAAGTTGCAACCTAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010099.2-628s21c1
Sequence:CCGGTAGGCGTGTTCGCCGCAATAACTCGAGTTATTGCGGCGAACACGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-638s1c1
Sequence:CCGGCGCCGCAATAAGAGAAGCAAACTCGAGTTTGCTTCTCTTATTGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1067s1c1
Sequence:CCGGGACGGCACCTACTTCATCTATCTCGAGATAGATGAAGTAGGTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1270s1c1
Sequence:CCGGGCACGCTGACATCTCTATCAACTCGAGTTGATAGAGATGTCAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1197s1c1
Sequence:CCGGCCAACTACAACACTTGCTATACTCGAGTATAGCAAGTGTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1016s1c1
Sequence:CCGGCCTAAGGTGTTTAAACTACATCTCGAGATGTAGTTTAAACACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010099
EDA MISSION shRNA shRNA Plasmid DNA
ectodysplasin A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010099.2-1008s21c1
Sequence:CCGGCTATGAACCCTAAGGTGTTTACTCGAGTAAACACCTTAGGGTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010099.2-1763s21c1
Sequence:CCGGTGCCATTAGGTTGCAACTTAACTCGAGTTAAGTTGCAACCTAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010099.2-628s21c1
Sequence:CCGGTAGGCGTGTTCGCCGCAATAACTCGAGTTATTGCGGCGAACACGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-638s1c1
Sequence:CCGGCGCCGCAATAAGAGAAGCAAACTCGAGTTTGCTTCTCTTATTGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1067s1c1
Sequence:CCGGGACGGCACCTACTTCATCTATCTCGAGATAGATGAAGTAGGTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1270s1c1
Sequence:CCGGGCACGCTGACATCTCTATCAACTCGAGTTGATAGAGATGTCAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1197s1c1
Sequence:CCGGCCAACTACAACACTTGCTATACTCGAGTATAGCAAGTGTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1016s1c1
Sequence:CCGGCCTAAGGTGTTTAAACTACATCTCGAGATGTAGTTTAAACACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010099
EDA MISSION shRNA Lentiviral Transduction Particles
ectodysplasin A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010099.2-1008s21c1
Sequence:CCGGCTATGAACCCTAAGGTGTTTACTCGAGTAAACACCTTAGGGTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010099.2-1763s21c1
Sequence:CCGGTGCCATTAGGTTGCAACTTAACTCGAGTTAAGTTGCAACCTAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010099.2-628s21c1
Sequence:CCGGTAGGCGTGTTCGCCGCAATAACTCGAGTTATTGCGGCGAACACGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-638s1c1
Sequence:CCGGCGCCGCAATAAGAGAAGCAAACTCGAGTTTGCTTCTCTTATTGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1067s1c1
Sequence:CCGGGACGGCACCTACTTCATCTATCTCGAGATAGATGAAGTAGGTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1270s1c1
Sequence:CCGGGCACGCTGACATCTCTATCAACTCGAGTTGATAGAGATGTCAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1197s1c1
Sequence:CCGGCCAACTACAACACTTGCTATACTCGAGTATAGCAAGTGTTGTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010099.1-1016s1c1
Sequence:CCGGCCTAAGGTGTTTAAACTACATCTCGAGATGTAGTTTAAACACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks