EMAIL THIS PAGE TO A FRIEND

EDAR

ectodysplasin A receptor

80 Gene Product Result for
Synonyms: DL ECTD10A ECTD10B ED1R ED3 ED5 EDA-A1R EDA1R EDA3 HRM1
UniProtKB ID: Q9UNE0, D3DX74, Q52LL5, Q9UND9
Gene ID:
Human(10913) Summary: This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
Mouse(13608) ectodysplasin-A receptor
Rat(365581) ectodysplasin-A receptor
Zebrafish(796370) ectodysplasin A receptor
Horse(100060614) ectodysplasin A receptor
cow(613947) ectodysplasin A receptor
domestic cat(101096644) ectodysplasin A receptor
chicken(428015) ectodysplasin A receptor
dog(481305) ectodysplasin A receptor
sheep(101109349) ectodysplasin A receptor
Domestic Rabbit(100358332) ectodysplasin A receptor
domestic guinea pig(100712926) ectodysplasin A receptor
naked mole-rat(101723207) ectodysplasin A receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0781 Mouse Edar ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022336 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022336 Rosetta Predictions human pricing
XM_345109 Rosetta Predictions rat pricing
NM_010100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355618 predicted 491
2 SASI_Hs01_00230261 predicted 684
3 SASI_Hs01_00230262 predicted 1383
4 SASI_Hs01_00230263 predicted 1474
5 SASI_Hs01_00230264 predicted 1376
6 SASI_Hs01_00230265 predicted 1519
7 SASI_Hs01_00230266 predicted 1851
8 SASI_Hs01_00230267 predicted 1829
9 SASI_Hs01_00230268 predicted 1496
10 SASI_Hs01_00230269 predicted 1591
11 SASI_Hs01_00230270 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398001 predicted 964
2 SASI_Rn02_00398002 predicted 947
3 SASI_Rn02_00398003 predicted 906
4 SASI_Rn02_00398004 predicted 305
5 SASI_Rn02_00398005 predicted 1295
6 SASI_Rn02_00398006 predicted 449
7 SASI_Rn02_00398007 predicted 1295
8 SASI_Rn02_00398008 predicted 387
9 SASI_Rn02_00398009 predicted 1164
10 SASI_Rn02_00398010 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195867 predicted 343
2 SASI_Mm01_00195868 predicted 1672
3 SASI_Mm01_00195869 predicted 1297
4 SASI_Mm01_00195870 predicted 691
5 SASI_Mm01_00195871 predicted 1326
6 SASI_Mm01_00195872 predicted 446
7 SASI_Mm01_00195873 predicted 811
8 SASI_Mm01_00195874 predicted 509
9 SASI_Mm01_00195875 predicted 1154
10 SASI_Mm01_00195876 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010100
EDAR MISSION shRNA Bacterial Glycerol Stock
ectodysplasin A receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-346s21c1
Sequence:CCGGCAACTGTGGTGAGAACGAATACTCGAGTATTCGTTCTCACCACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010100.3-2097s21c1
Sequence:CCGGCAGTCACACACCATGGTATAACTCGAGTTATACCATGGTGTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-492s21c1
Sequence:CCGGAGTTCTCCAAAGGAGGTTATCCTCGAGGATAACCTCCTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-434s21c1
Sequence:CCGGTCCTGTGGATACGGCACTAAACTCGAGTTTAGTGCCGTATCCACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-1492s1c1
Sequence:CCGGGCTCACAAAGTTGGTGCAGATCTCGAGATCTGCACCAACTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-1315s1c1
Sequence:CCGGCCTTGAGAAGACAAGCCGAATCTCGAGATTCGGCTTGTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-956s1c1
Sequence:CCGGGCTAACACACACGAGGAGAAACTCGAGTTTCTCCTCGTGTGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-819s1c1
Sequence:CCGGCCCTGATTATTGCCATGTCTACTCGAGTAGACATGGCAATAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-345s1c1
Sequence:CCGGCCAACTGTGGTGAGAACGAATCTCGAGATTCGTTCTCACCACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010100
EDAR MISSION shRNA shRNA Plasmid DNA
ectodysplasin A receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-346s21c1
Sequence:CCGGCAACTGTGGTGAGAACGAATACTCGAGTATTCGTTCTCACCACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010100.3-2097s21c1
Sequence:CCGGCAGTCACACACCATGGTATAACTCGAGTTATACCATGGTGTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-492s21c1
Sequence:CCGGAGTTCTCCAAAGGAGGTTATCCTCGAGGATAACCTCCTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-434s21c1
Sequence:CCGGTCCTGTGGATACGGCACTAAACTCGAGTTTAGTGCCGTATCCACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-1492s1c1
Sequence:CCGGGCTCACAAAGTTGGTGCAGATCTCGAGATCTGCACCAACTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-1315s1c1
Sequence:CCGGCCTTGAGAAGACAAGCCGAATCTCGAGATTCGGCTTGTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-956s1c1
Sequence:CCGGGCTAACACACACGAGGAGAAACTCGAGTTTCTCCTCGTGTGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-819s1c1
Sequence:CCGGCCCTGATTATTGCCATGTCTACTCGAGTAGACATGGCAATAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-345s1c1
Sequence:CCGGCCAACTGTGGTGAGAACGAATCTCGAGATTCGTTCTCACCACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010100
EDAR MISSION shRNA Lentiviral Transduction Particles
ectodysplasin A receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-346s21c1
Sequence:CCGGCAACTGTGGTGAGAACGAATACTCGAGTATTCGTTCTCACCACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010100.3-2097s21c1
Sequence:CCGGCAGTCACACACCATGGTATAACTCGAGTTATACCATGGTGTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-492s21c1
Sequence:CCGGAGTTCTCCAAAGGAGGTTATCCTCGAGGATAACCTCCTTTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010100.3-434s21c1
Sequence:CCGGTCCTGTGGATACGGCACTAAACTCGAGTTTAGTGCCGTATCCACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-1492s1c1
Sequence:CCGGGCTCACAAAGTTGGTGCAGATCTCGAGATCTGCACCAACTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-1315s1c1
Sequence:CCGGCCTTGAGAAGACAAGCCGAATCTCGAGATTCGGCTTGTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-956s1c1
Sequence:CCGGGCTAACACACACGAGGAGAAACTCGAGTTTCTCCTCGTGTGTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-819s1c1
Sequence:CCGGCCCTGATTATTGCCATGTCTACTCGAGTAGACATGGCAATAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010100.1-345s1c1
Sequence:CCGGCCAACTGTGGTGAGAACGAATCTCGAGATTCGTTCTCACCACAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022336
EDAR MISSION shRNA Bacterial Glycerol Stock
ectodysplasin A receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022336.3-1961s21c1
Sequence:CCGGGACTAGAGCCGGGATACTTTCCTCGAGGAAAGTATCCCGGCTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022336.3-1240s21c1
Sequence:CCGGACGATGCCTCATCCGAGAATGCTCGAGCATTCTCGGATGAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022336.3-1909s21c1
Sequence:CCGGTCAAGGAGCCAGACGAAATAACTCGAGTTATTTCGTCTGGCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022336.3-1382s21c1
Sequence:CCGGCAAGTCAGCCGGGATTCAAAGCTCGAGCTTTGAATCCCGGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1392s1c1
Sequence:CCGGCGGGATTCAAAGCCGGAGGAACTCGAGTTCCTCCGGCTTTGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-525s1c1
Sequence:CCGGCGGTGAGAACGAGTACTACAACTCGAGTTGTAGTACTCGTTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1182s1c1
Sequence:CCGGCGAGAAGGATGAATTTGAGAACTCGAGTTCTCAAATTCATCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1041s1c1
Sequence:CCGGCCTCATCATCATGTTCTACATCTCGAGATGTAGAACATGATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1476s1c1
Sequence:CCGGGCCATTTGATTGCCTCGAGAACTCGAGTTCTCGAGGCAATCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022336
EDAR MISSION shRNA shRNA Plasmid DNA
ectodysplasin A receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022336.3-1961s21c1
Sequence:CCGGGACTAGAGCCGGGATACTTTCCTCGAGGAAAGTATCCCGGCTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022336.3-1240s21c1
Sequence:CCGGACGATGCCTCATCCGAGAATGCTCGAGCATTCTCGGATGAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022336.3-1909s21c1
Sequence:CCGGTCAAGGAGCCAGACGAAATAACTCGAGTTATTTCGTCTGGCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022336.3-1382s21c1
Sequence:CCGGCAAGTCAGCCGGGATTCAAAGCTCGAGCTTTGAATCCCGGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1392s1c1
Sequence:CCGGCGGGATTCAAAGCCGGAGGAACTCGAGTTCCTCCGGCTTTGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-525s1c1
Sequence:CCGGCGGTGAGAACGAGTACTACAACTCGAGTTGTAGTACTCGTTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1182s1c1
Sequence:CCGGCGAGAAGGATGAATTTGAGAACTCGAGTTCTCAAATTCATCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1041s1c1
Sequence:CCGGCCTCATCATCATGTTCTACATCTCGAGATGTAGAACATGATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1476s1c1
Sequence:CCGGGCCATTTGATTGCCTCGAGAACTCGAGTTCTCGAGGCAATCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022336
EDAR MISSION shRNA Lentiviral Transduction Particles
ectodysplasin A receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022336.3-1961s21c1
Sequence:CCGGGACTAGAGCCGGGATACTTTCCTCGAGGAAAGTATCCCGGCTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022336.3-1240s21c1
Sequence:CCGGACGATGCCTCATCCGAGAATGCTCGAGCATTCTCGGATGAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022336.3-1909s21c1
Sequence:CCGGTCAAGGAGCCAGACGAAATAACTCGAGTTATTTCGTCTGGCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022336.3-1382s21c1
Sequence:CCGGCAAGTCAGCCGGGATTCAAAGCTCGAGCTTTGAATCCCGGCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1392s1c1
Sequence:CCGGCGGGATTCAAAGCCGGAGGAACTCGAGTTCCTCCGGCTTTGAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-525s1c1
Sequence:CCGGCGGTGAGAACGAGTACTACAACTCGAGTTGTAGTACTCGTTCTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1182s1c1
Sequence:CCGGCGAGAAGGATGAATTTGAGAACTCGAGTTCTCAAATTCATCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1041s1c1
Sequence:CCGGCCTCATCATCATGTTCTACATCTCGAGATGTAGAACATGATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022336.1-1476s1c1
Sequence:CCGGGCCATTTGATTGCCTCGAGAACTCGAGTTCTCGAGGCAATCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks