EMAIL THIS PAGE TO A FRIEND

EDARADD

EDAR-associated death domain

Synonyms: ECTD11A ECTD11B ED3 EDA3
UniProtKB ID: Q8WWZ3, A2VCK5, A8K7B5, B1AL54, B9ZVW5, Q5VYJ7
Gene ID:
Human(128178) Summary: This gene was identified by its association with ectodermal dysplasia, a genetic disorder characterized by defective development of hair, teeth, and eccrine sweat glands. The protein encoded by this gene is a death domain-containing protein, and is found to interact with EDAR, a death domain receptor known to be required for the development of hair, teeth and other ectodermal derivatives. This protein and EDAR are coexpressed in epithelial cells during the formation of hair follicles and teeth. Through its interaction with EDAR, this protein acts as an adaptor, and links the receptor to downstream signaling pathways. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(171211) EDAR (ectodysplasin-A receptor)-associated death domain
Rat(498769) EDAR-associated death domain
naked mole-rat(101704944) EDAR-associated death domain
domestic guinea pig(100169691) EDAR (ectodysplasin-A receptor)-associated death domain
sheep(101115598) EDAR-associated death domain
Zebrafish(566761) EDAR-associated death domain
cow(518089) EDAR-associated death domain
domestic cat(101085497) EDAR-associated death domain
dog(607372) EDAR-associated death domain
chicken(497625) EDAR-associated death domain
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080738 Rosetta Predictions human pricing
NM_145861 Rosetta Predictions human pricing
XM_001054456 Rosetta Predictions rat pricing
XM_574055 Rosetta Predictions rat pricing
NM_133643 Rosetta Predictions mouse pricing
NM_175746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239123 predicted 539
2 SASI_Hs01_00239124 predicted 1194
3 SASI_Hs01_00239126 predicted 1313
4 SASI_Hs01_00239127 predicted 456
5 SASI_Hs01_00239128 predicted 819
6 SASI_Hs01_00239129 predicted 1101
7 SASI_Hs01_00239130 predicted 883
8 SASI_Hs01_00239131 predicted 876
9 SASI_Hs01_00239132 predicted 519
10 SASI_Hs02_00362522 predicted 1207
11 SASI_Hs01_00239125 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053288 predicted 420
2 SASI_Hs01_00053289 predicted 1076
3 SASI_Hs01_00053291 predicted 1191
4 SASI_Hs01_00053292 predicted 341
5 SASI_Hs01_00053293 predicted 704
6 SASI_Hs01_00053294 predicted 983
7 SASI_Hs01_00053295 predicted 769
8 SASI_Hs01_00053296 predicted 762
9 SASI_Hs01_00053297 predicted 394
10 SASI_Hs02_00365389 predicted 1084
11 SASI_Hs01_00053290 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275878 predicted 805
2 SASI_Rn02_00275879 predicted 641
3 SASI_Rn02_00275880 predicted 640
4 SASI_Rn02_00275881 predicted 862
5 SASI_Rn02_00275882 predicted 620
6 SASI_Rn02_00275883 predicted 495
7 SASI_Rn02_00275884 predicted 592
8 SASI_Rn02_00275885 predicted 831
9 SASI_Rn02_00275886 predicted 806
10 SASI_Rn02_00275887 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401276 predicted 568
2 SASI_Rn02_00401277 predicted 415
3 SASI_Rn02_00401278 predicted 596
4 SASI_Rn02_00401279 predicted 624
5 SASI_Rn02_00401280 predicted 387
6 SASI_Rn02_00401281 predicted 247
7 SASI_Rn02_00401282 predicted 364
8 SASI_Rn02_00401283 predicted 603
9 SASI_Rn02_00401284 predicted 578
10 SASI_Rn02_00401285 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338571 predicted 574
2 SASI_Mm02_00338572 predicted 833
3 SASI_Mm02_00338573 predicted 1186
4 SASI_Mm02_00338574 predicted 856
5 SASI_Mm02_00338575 predicted 583
6 SASI_Mm02_00338576 predicted 628
7 SASI_Mm02_00338577 predicted 1181
8 SASI_Mm01_00140862 predicted 1362
9 SASI_Mm02_00338578 predicted 517
10 SASI_Mm02_00338579 predicted 862
11 SASI_Mm01_00140858 predicted 1190
12 SASI_Mm01_00140859 predicted 1205
13 SASI_Mm01_00140860 predicted 1191
14 SASI_Mm01_00140861 predicted 1212
15 SASI_Mm01_00140863 predicted 1098
16 SASI_Mm01_00140864 predicted 1089
17 SASI_Mm01_00140865 predicted 1160
18 SASI_Mm01_00140866 predicted 1105
19 SASI_Mm01_00140867 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149755 predicted 1334
2 SASI_Mm01_00149756 predicted 1349
3 SASI_Mm01_00149757 predicted 1326
4 SASI_Mm01_00149758 predicted 1345
5 SASI_Mm01_00149759 predicted 1326
6 SASI_Mm01_00149760 predicted 1243
7 SASI_Mm01_00149761 predicted 1225
8 SASI_Mm01_00149762 predicted 1308
9 SASI_Mm01_00149763 predicted 1243
10 SASI_Mm01_00149764 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080738
EDARADD MISSION shRNA Bacterial Glycerol Stock
EDAR-associated death domain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080738.2-1789s1c1
Sequence:CCGGCCGGTGTTCAATGTCATCAATCTCGAGATTGATGACATTGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-481s1c1
Sequence:CCGGCTGTACTTGTTCCTCCTGCTTCTCGAGAAGCAGGAGGAACAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-373s1c1
Sequence:CCGGCTGCCCACGAAATTCAGATATCTCGAGATATCTGAATTTCGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-376s1c1
Sequence:CCGGCCCACGAAATTCAGATATGAACTCGAGTTCATATCTGAATTTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-280s1c1
Sequence:CCGGCCCTAGCACTTTATCCTTTAACTCGAGTTAAAGGATAAAGTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080738.2-332s1c1
Sequence:CCGGGAACTCCCTAAAGCTGAAGAACTCGAGTTCTTCAGCTTTAGGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-281s21c1
Sequence:CCGGCCTAGCACTTTATCCTTTAATCTCGAGATTAAAGGATAAAGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-323s21c1
Sequence:CCGGCAAGATACGGAACTCCCTAAACTCGAGTTTAGGGAGTTCCGTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-367s21c1
Sequence:CCGGTTTGAACTGCCCACGAAATTCCTCGAGGAATTTCGTGGGCAGTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080738
EDARADD MISSION shRNA shRNA Plasmid DNA
EDAR-associated death domain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080738.2-1789s1c1
Sequence:CCGGCCGGTGTTCAATGTCATCAATCTCGAGATTGATGACATTGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-481s1c1
Sequence:CCGGCTGTACTTGTTCCTCCTGCTTCTCGAGAAGCAGGAGGAACAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-373s1c1
Sequence:CCGGCTGCCCACGAAATTCAGATATCTCGAGATATCTGAATTTCGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-376s1c1
Sequence:CCGGCCCACGAAATTCAGATATGAACTCGAGTTCATATCTGAATTTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-280s1c1
Sequence:CCGGCCCTAGCACTTTATCCTTTAACTCGAGTTAAAGGATAAAGTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080738.2-332s1c1
Sequence:CCGGGAACTCCCTAAAGCTGAAGAACTCGAGTTCTTCAGCTTTAGGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-281s21c1
Sequence:CCGGCCTAGCACTTTATCCTTTAATCTCGAGATTAAAGGATAAAGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-323s21c1
Sequence:CCGGCAAGATACGGAACTCCCTAAACTCGAGTTTAGGGAGTTCCGTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-367s21c1
Sequence:CCGGTTTGAACTGCCCACGAAATTCCTCGAGGAATTTCGTGGGCAGTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080738
EDARADD MISSION shRNA Lentiviral Transduction Particles
EDAR-associated death domain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080738.2-1789s1c1
Sequence:CCGGCCGGTGTTCAATGTCATCAATCTCGAGATTGATGACATTGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-481s1c1
Sequence:CCGGCTGTACTTGTTCCTCCTGCTTCTCGAGAAGCAGGAGGAACAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-373s1c1
Sequence:CCGGCTGCCCACGAAATTCAGATATCTCGAGATATCTGAATTTCGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-376s1c1
Sequence:CCGGCCCACGAAATTCAGATATGAACTCGAGTTCATATCTGAATTTCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080738.2-280s1c1
Sequence:CCGGCCCTAGCACTTTATCCTTTAACTCGAGTTAAAGGATAAAGTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080738.2-332s1c1
Sequence:CCGGGAACTCCCTAAAGCTGAAGAACTCGAGTTCTTCAGCTTTAGGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-281s21c1
Sequence:CCGGCCTAGCACTTTATCCTTTAATCTCGAGATTAAAGGATAAAGTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-323s21c1
Sequence:CCGGCAAGATACGGAACTCCCTAAACTCGAGTTTAGGGAGTTCCGTATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080738.3-367s21c1
Sequence:CCGGTTTGAACTGCCCACGAAATTCCTCGAGGAATTTCGTGGGCAGTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133643
EDARADD MISSION shRNA Bacterial Glycerol Stock
EDAR-associated death domain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-967s1c1
Sequence:CCGGGCTGGAGTTCTTATTCCGAAACTCGAGTTTCGGAATAAGAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-662s1c1
Sequence:CCGGCCAAATTCTGATGACCAACCTCTCGAGAGGTTGGTCATCAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-915s1c1
Sequence:CCGGGCATGCCCTATGATGAACTGTCTCGAGACAGTTCATCATAGGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-620s1c1
Sequence:CCGGCCTAAAGCTAAAGAGTGTGATCTCGAGATCACACTCTTTAGCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-652s21c1
Sequence:CCGGATTCCAACTGTCCACCAAATTCTCGAGAATTTGGTGGACAGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-830s21c1
Sequence:CCGGCGATCAGGACTTGCTAGATACCTCGAGGTATCTAGCAAGTCCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133643.3-1604s21c1
Sequence:CCGGATAATGTGGCCCAGGTATATGCTCGAGCATATACCTGGGCCACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-966s21c1
Sequence:CCGGCCCACGCTGGAGTTCTTATTCCTCGAGGAATAAGAACTCCAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-615s21c1
Sequence:CCGGACCGGCCTCCCTAAAGCTAAACTCGAGTTTAGCTTTAGGGAGGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133643
EDARADD MISSION shRNA shRNA Plasmid DNA
EDAR-associated death domain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-967s1c1
Sequence:CCGGGCTGGAGTTCTTATTCCGAAACTCGAGTTTCGGAATAAGAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-662s1c1
Sequence:CCGGCCAAATTCTGATGACCAACCTCTCGAGAGGTTGGTCATCAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-915s1c1
Sequence:CCGGGCATGCCCTATGATGAACTGTCTCGAGACAGTTCATCATAGGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-620s1c1
Sequence:CCGGCCTAAAGCTAAAGAGTGTGATCTCGAGATCACACTCTTTAGCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-652s21c1
Sequence:CCGGATTCCAACTGTCCACCAAATTCTCGAGAATTTGGTGGACAGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-830s21c1
Sequence:CCGGCGATCAGGACTTGCTAGATACCTCGAGGTATCTAGCAAGTCCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133643.3-1604s21c1
Sequence:CCGGATAATGTGGCCCAGGTATATGCTCGAGCATATACCTGGGCCACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-966s21c1
Sequence:CCGGCCCACGCTGGAGTTCTTATTCCTCGAGGAATAAGAACTCCAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-615s21c1
Sequence:CCGGACCGGCCTCCCTAAAGCTAAACTCGAGTTTAGCTTTAGGGAGGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133643
EDARADD MISSION shRNA Lentiviral Transduction Particles
EDAR-associated death domain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-967s1c1
Sequence:CCGGGCTGGAGTTCTTATTCCGAAACTCGAGTTTCGGAATAAGAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-662s1c1
Sequence:CCGGCCAAATTCTGATGACCAACCTCTCGAGAGGTTGGTCATCAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-915s1c1
Sequence:CCGGGCATGCCCTATGATGAACTGTCTCGAGACAGTTCATCATAGGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133643.1-620s1c1
Sequence:CCGGCCTAAAGCTAAAGAGTGTGATCTCGAGATCACACTCTTTAGCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-652s21c1
Sequence:CCGGATTCCAACTGTCCACCAAATTCTCGAGAATTTGGTGGACAGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-830s21c1
Sequence:CCGGCGATCAGGACTTGCTAGATACCTCGAGGTATCTAGCAAGTCCTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133643.3-1604s21c1
Sequence:CCGGATAATGTGGCCCAGGTATATGCTCGAGCATATACCTGGGCCACATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-966s21c1
Sequence:CCGGCCCACGCTGGAGTTCTTATTCCTCGAGGAATAAGAACTCCAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133643.3-615s21c1
Sequence:CCGGACCGGCCTCCCTAAAGCTAAACTCGAGTTTAGCTTTAGGGAGGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks