EMAIL THIS PAGE TO A FRIEND

EDC3

enhancer of mRNA decapping 3

80 Gene Product Result for
Synonyms: LSM16 YJDC YJEFN2
UniProtKB ID: Q96F86, B3KPH0, D3DW61, Q9H797
Gene ID:
Human(80153) Summary: EDC3 is associated with an mRNA-decapping complex required for removal of the 5-prime cap from mRNA prior to its degradation from the 5-prime end (Fenger-Gron et al., 2005 [PubMed 16364915]
Mouse(353190) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
Rat(315708) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
Zebrafish(504054) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
cow(517979) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
Horse(100051601) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
fruit fly(39957) Enhancer of decapping 3
domestic cat(101083593) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
dog(487647) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
chicken(415294) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
sheep(101109486) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
Domestic Rabbit(100345820) enhancer of mRNA decapping 3 homolog (S. cerevisiae)
domestic guinea pig(100725172) enhancer of mRNA decapping 3
naked mole-rat(101705814) enhancer of mRNA decapping 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025083 Rosetta Predictions human pricing
XM_001072079 Rosetta Predictions rat pricing
XM_001072111 Rosetta Predictions rat pricing
XM_236291 Rosetta Predictions rat pricing
NM_153799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234428 predicted 193
2 SASI_Hs01_00234429 predicted 1737
3 SASI_Hs02_00357783 predicted 811
4 SASI_Hs01_00234430 predicted 1323
5 SASI_Hs01_00234431 predicted 801
6 SASI_Hs01_00234432 predicted 1736
7 SASI_Hs01_00234434 predicted 640
8 SASI_Hs01_00234435 predicted 1649
9 SASI_Hs02_00357784 predicted 1017
10 SASI_Hs01_00234436 predicted 506
11 SASI_Hs01_00234433 predicted 807
12 SASI_Hs01_00234437 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337730 predicted 697
2 SASI_Rn02_00337731 predicted 1130
3 SASI_Rn02_00337732 predicted 1748
4 SASI_Rn02_00337733 predicted 201
5 SASI_Rn02_00337734 predicted 1375
6 SASI_Rn02_00337735 predicted 812
7 SASI_Rn02_00337736 predicted 1262
8 SASI_Rn02_00337737 predicted 1295
9 SASI_Rn02_00337738 predicted 599
10 SASI_Rn02_00337739 predicted 1757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337865 predicted 716
2 SASI_Rn02_00337866 predicted 1145
3 SASI_Rn02_00337867 predicted 1755
4 SASI_Rn02_00337868 predicted 212
5 SASI_Rn02_00337869 predicted 1390
6 SASI_Rn02_00337870 predicted 826
7 SASI_Rn02_00337871 predicted 1271
8 SASI_Rn02_00337872 predicted 1301
9 SASI_Rn02_00337873 predicted 606
10 SASI_Rn02_00337874 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193703 predicted 359
2 SASI_Rn01_00193704 predicted 602
3 SASI_Rn01_00193705 predicted 509
4 SASI_Rn01_00193706 predicted 308
5 SASI_Rn01_00193707 predicted 294
6 SASI_Rn01_00193708 predicted 316
7 SASI_Rn01_00193709 predicted 260
8 SASI_Rn01_00193710 predicted 232
9 SASI_Rn01_00193711 predicted 521
10 SASI_Rn01_00193712 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158880 predicted 1738
2 SASI_Mm02_00343535 predicted 1120
3 SASI_Mm01_00158881 predicted 297
4 SASI_Mm01_00158883 predicted 582
5 SASI_Mm01_00158884 predicted 424
6 SASI_Mm01_00158885 predicted 1752
7 SASI_Mm01_00158886 predicted 1253
8 SASI_Mm01_00158887 predicted 1045
9 SASI_Mm01_00158888 predicted 1252
10 SASI_Mm01_00158889 predicted 1031
11 SASI_Mm01_00158882 predicted 1740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025083
VALIDATED
EDC3 MISSION shRNA Bacterial Glycerol Stock
enhancer of mRNA decapping 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025083.3-2079s21c1
Sequence:CCGGGGCCTGTACCTGCTCTATTTCCTCGAGGAAATAGAGCAGGTACAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-1011s21c1
Sequence:CCGGGCCTGGTTGTCCCAAGTATTTCTCGAGAAATACTTGGGACAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-833s21c1
Sequence:CCGGGCTGTGTTTGAGGAGATTGATCTCGAGATCAATCTCCTCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-1354s21c1
Sequence:CCGGCCAACAAGTGTCTAGCCTCAACTCGAGTTGAGGCTAGACACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1328s1c1
Sequence:CCGGCCAACAAGTGTCTAGCCTCAACTCGAGTTGAGGCTAGACACTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1329s1c1
Sequence:CCGGCAACAAGTGTCTAGCCTCAAACTCGAGTTTGAGGCTAGACACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-1971s1c1
Sequence:CCGGGCAGCTCTCAAGACTGTGTTTCTCGAGAAACACAGTCTTGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1574s1c1
Sequence:CCGGCCGTATCTATTTGTGCGACATCTCGAGATGTCGCACAAATAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-807s1c1
Sequence:CCGGGCTGTGTTTGAGGAGATTGATCTCGAGATCAATCTCCTCAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1575s1c1
Sequence:CCGGCGTATCTATTTGTGCGACATTCTCGAGAATGTCGCACAAATAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-2395s1c1
Sequence:CCGGGCACAGGTAGTATAAGGTTATCTCGAGATAACCTTATACTACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1125s1c1
Sequence:CCGGCCTAACAGGTTGAATCCCAAACTCGAGTTTGGGATTCAACCTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-186s1c1
Sequence:CCGGGTGTCCATCAATTGTGGAGATCTCGAGATCTCCACAATTGATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025083
VALIDATED
EDC3 MISSION shRNA shRNA Plasmid DNA
enhancer of mRNA decapping 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025083.3-2079s21c1
Sequence:CCGGGGCCTGTACCTGCTCTATTTCCTCGAGGAAATAGAGCAGGTACAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-1011s21c1
Sequence:CCGGGCCTGGTTGTCCCAAGTATTTCTCGAGAAATACTTGGGACAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-833s21c1
Sequence:CCGGGCTGTGTTTGAGGAGATTGATCTCGAGATCAATCTCCTCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-1354s21c1
Sequence:CCGGCCAACAAGTGTCTAGCCTCAACTCGAGTTGAGGCTAGACACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1328s1c1
Sequence:CCGGCCAACAAGTGTCTAGCCTCAACTCGAGTTGAGGCTAGACACTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1329s1c1
Sequence:CCGGCAACAAGTGTCTAGCCTCAAACTCGAGTTTGAGGCTAGACACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-1971s1c1
Sequence:CCGGGCAGCTCTCAAGACTGTGTTTCTCGAGAAACACAGTCTTGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1574s1c1
Sequence:CCGGCCGTATCTATTTGTGCGACATCTCGAGATGTCGCACAAATAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-807s1c1
Sequence:CCGGGCTGTGTTTGAGGAGATTGATCTCGAGATCAATCTCCTCAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1575s1c1
Sequence:CCGGCGTATCTATTTGTGCGACATTCTCGAGAATGTCGCACAAATAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-2395s1c1
Sequence:CCGGGCACAGGTAGTATAAGGTTATCTCGAGATAACCTTATACTACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1125s1c1
Sequence:CCGGCCTAACAGGTTGAATCCCAAACTCGAGTTTGGGATTCAACCTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-186s1c1
Sequence:CCGGGTGTCCATCAATTGTGGAGATCTCGAGATCTCCACAATTGATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025083
VALIDATED
EDC3 MISSION shRNA Lentiviral Transduction Particles
enhancer of mRNA decapping 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025083.3-2079s21c1
Sequence:CCGGGGCCTGTACCTGCTCTATTTCCTCGAGGAAATAGAGCAGGTACAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-1011s21c1
Sequence:CCGGGCCTGGTTGTCCCAAGTATTTCTCGAGAAATACTTGGGACAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-833s21c1
Sequence:CCGGGCTGTGTTTGAGGAGATTGATCTCGAGATCAATCTCCTCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_025083.3-1354s21c1
Sequence:CCGGCCAACAAGTGTCTAGCCTCAACTCGAGTTGAGGCTAGACACTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1328s1c1
Sequence:CCGGCCAACAAGTGTCTAGCCTCAACTCGAGTTGAGGCTAGACACTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1329s1c1
Sequence:CCGGCAACAAGTGTCTAGCCTCAAACTCGAGTTTGAGGCTAGACACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-1971s1c1
Sequence:CCGGGCAGCTCTCAAGACTGTGTTTCTCGAGAAACACAGTCTTGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1574s1c1
Sequence:CCGGCCGTATCTATTTGTGCGACATCTCGAGATGTCGCACAAATAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-807s1c1
Sequence:CCGGGCTGTGTTTGAGGAGATTGATCTCGAGATCAATCTCCTCAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1575s1c1
Sequence:CCGGCGTATCTATTTGTGCGACATTCTCGAGAATGTCGCACAAATAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025083.2-2395s1c1
Sequence:CCGGGCACAGGTAGTATAAGGTTATCTCGAGATAACCTTATACTACCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160705    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-1125s1c1
Sequence:CCGGCCTAACAGGTTGAATCCCAAACTCGAGTTTGGGATTCAACCTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025083.2-186s1c1
Sequence:CCGGGTGTCCATCAATTGTGGAGATCTCGAGATCTCCACAATTGATGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153799
VALIDATED
EDC3 MISSION shRNA Bacterial Glycerol Stock
enhancer of mRNA decapping 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-803s21c1
Sequence:CCGGTTTGAGGAGATCGACACTTACCTCGAGGTAAGTGTCGATCTCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.3-1264s1c1
Sequence:CCGGCAAGATGCTGGAGTCTATTACCTCGAGGTAATAGACTCCAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-1263s21c1
Sequence:CCGGTCAAGATGCTGGAGTCTATTACTCGAGTAATAGACTCCAGCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-715s21c1
Sequence:CCGGCGAGTGCTTTGGAGACGATATCTCGAGATATCGTCTCCAAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153799.3-2412s21c1
Sequence:CCGGTTGGTGCTTCTACCATCATTTCTCGAGAAATGATGGTAGAAGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153799.3-306s21c1
Sequence:CCGGCCTTTCGGGCAGGTGATATTACTCGAGTAATATCACCTGCCCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153799.1-1920s1c1
Sequence:CCGGGCCTCCATTAAACTGGAGCTTCTCGAGAAGCTCCAGTTTAATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.1-1491s1c1
Sequence:CCGGGAAGTTGAACAGGGCATTGATCTCGAGATCAATGCCCTGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.1-379s1c1
Sequence:CCGGGAGACCTTCATCAGACAGAATCTCGAGATTCTGTCTGATGAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153799
VALIDATED
EDC3 MISSION shRNA shRNA Plasmid DNA
enhancer of mRNA decapping 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-803s21c1
Sequence:CCGGTTTGAGGAGATCGACACTTACCTCGAGGTAAGTGTCGATCTCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.3-1264s1c1
Sequence:CCGGCAAGATGCTGGAGTCTATTACCTCGAGGTAATAGACTCCAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-1263s21c1
Sequence:CCGGTCAAGATGCTGGAGTCTATTACTCGAGTAATAGACTCCAGCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-715s21c1
Sequence:CCGGCGAGTGCTTTGGAGACGATATCTCGAGATATCGTCTCCAAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153799.3-2412s21c1
Sequence:CCGGTTGGTGCTTCTACCATCATTTCTCGAGAAATGATGGTAGAAGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153799.3-306s21c1
Sequence:CCGGCCTTTCGGGCAGGTGATATTACTCGAGTAATATCACCTGCCCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153799.1-1920s1c1
Sequence:CCGGGCCTCCATTAAACTGGAGCTTCTCGAGAAGCTCCAGTTTAATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.1-1491s1c1
Sequence:CCGGGAAGTTGAACAGGGCATTGATCTCGAGATCAATGCCCTGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.1-379s1c1
Sequence:CCGGGAGACCTTCATCAGACAGAATCTCGAGATTCTGTCTGATGAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153799
VALIDATED
EDC3 MISSION shRNA Lentiviral Transduction Particles
enhancer of mRNA decapping 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-803s21c1
Sequence:CCGGTTTGAGGAGATCGACACTTACCTCGAGGTAAGTGTCGATCTCCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.3-1264s1c1
Sequence:CCGGCAAGATGCTGGAGTCTATTACCTCGAGGTAATAGACTCCAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-1263s21c1
Sequence:CCGGTCAAGATGCTGGAGTCTATTACTCGAGTAATAGACTCCAGCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153799.3-715s21c1
Sequence:CCGGCGAGTGCTTTGGAGACGATATCTCGAGATATCGTCTCCAAAGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153799.3-2412s21c1
Sequence:CCGGTTGGTGCTTCTACCATCATTTCTCGAGAAATGATGGTAGAAGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153799.3-306s21c1
Sequence:CCGGCCTTTCGGGCAGGTGATATTACTCGAGTAATATCACCTGCCCGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196021    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153799.1-1920s1c1
Sequence:CCGGGCCTCCATTAAACTGGAGCTTCTCGAGAAGCTCCAGTTTAATGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.1-1491s1c1
Sequence:CCGGGAAGTTGAACAGGGCATTGATCTCGAGATCAATGCCCTGTTCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153799.1-379s1c1
Sequence:CCGGGAGACCTTCATCAGACAGAATCTCGAGATTCTGTCTGATGAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks