EMAIL THIS PAGE TO A FRIEND

EDC4

enhancer of mRNA decapping 4

88 Gene Product Result for
Synonyms: GE1 Ge-1 HEDL5 HEDLS RCD-8 RCD8
Gene ID:
Mouse(234699) enhancer of mRNA decapping 4
Rat(361399) enhancer of mRNA decapping 4
naked mole-rat(101702722) enhancer of mRNA decapping 4
domestic guinea pig(100730471) enhancer of mRNA decapping 4
sheep(101110083) enhancer of mRNA decapping 4
Domestic Rabbit(100352833) enhancer of mRNA decapping 4
Zebrafish(565659) enhancer of mRNA decapping 4
cow(513171) enhancer of mRNA decapping 4
Horse(100053605) enhancer of mRNA decapping 4
domestic cat(101081688) enhancer of mRNA decapping 4
dog(489751) enhancer of mRNA decapping 4
chicken(415656) enhancer of mRNA decapping 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014329 Rosetta Predictions human pricing
NM_001033068 Rosetta Predictions rat pricing
NM_181594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135924 predicted 2741
2 SASI_Hs01_00135925 predicted 2351
3 SASI_Hs01_00135926 predicted 332
4 SASI_Hs01_00135927 predicted 3960
5 SASI_Hs01_00135929 predicted 1155
6 SASI_Hs01_00135930 predicted 3556
7 SASI_Hs01_00135931 predicted 4290
8 SASI_Hs02_00345453 predicted 1225
9 SASI_Hs01_00135933 predicted 528
10 SASI_Hs02_00345454 predicted 585
11 SASI_Hs01_00135928 predicted 1364
12 SASI_Hs01_00135932 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045752 predicted 326
2 SASI_Rn01_00045750 predicted 1364
3 SASI_Rn01_00045751 predicted 3827
4 SASI_Rn01_00045753 predicted 1424
5 SASI_Rn02_00203629 predicted 1191
6 SASI_Rn02_00203630 predicted 1263
7 SASI_Rn01_00045754 predicted 1183
8 SASI_Rn01_00045755 predicted 590
9 SASI_Rn01_00045756 predicted 576
10 SASI_Rn02_00203631 predicted 3446
11 SASI_Rn01_00045757 predicted 3035
12 SASI_Rn01_00045758 predicted 3591
13 SASI_Rn01_00045759 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076079 predicted 1183
2 SASI_Mm01_00076080 predicted 1310
3 SASI_Mm01_00076081 predicted 3491
4 SASI_Mm01_00076082 predicted 1376
5 SASI_Mm01_00076083 predicted 533
6 SASI_Mm01_00076084 predicted 3367
7 SASI_Mm01_00076085 predicted 291
8 SASI_Mm01_00076086 predicted 565
9 SASI_Mm01_00076087 predicted 973
10 SASI_Mm02_00349868 predicted 3500
11 SASI_Mm01_00076088 predicted 2432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181594
VALIDATED
EDC4 MISSION shRNA Bacterial Glycerol Stock
enhancer of mRNA decapping 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-2947s1c1
Sequence:CCGGGCACTAATTTGGCAGCAGCAACTCGAGTTGCTGCTGCCAAATTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-977s1c1
Sequence:CCGGGCCAAATCAAGCAAGGCTTTACTCGAGTAAAGCCTTGCTTGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-3727s1c1
Sequence:CCGGCAGGAGTCAATCTTAGCACAACTCGAGTTGTGCTAAGATTGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-170s21c1
Sequence:CCGGATCTGCGGGACATACTCAAACCTCGAGGTTTGAGTATGTCCCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-4437s21c1
Sequence:CCGGTGCTCTACTGATTGTGGTAACCTCGAGGTTACCACAATCAGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-2937s21c1
Sequence:CCGGAGACTGGCCAGCACTAATTTGCTCGAGCAAATTAGTGCTGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-1089s21c1
Sequence:CCGGCAAGTTCTGGCAGATCTATATCTCGAGATATAGATCTGCCAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-305s21c1
Sequence:CCGGCAACGAACAAACCTGGTATACCTCGAGGTATACCAGGTTTGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181594
VALIDATED
EDC4 MISSION shRNA shRNA Plasmid DNA
enhancer of mRNA decapping 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-2947s1c1
Sequence:CCGGGCACTAATTTGGCAGCAGCAACTCGAGTTGCTGCTGCCAAATTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-977s1c1
Sequence:CCGGGCCAAATCAAGCAAGGCTTTACTCGAGTAAAGCCTTGCTTGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-3727s1c1
Sequence:CCGGCAGGAGTCAATCTTAGCACAACTCGAGTTGTGCTAAGATTGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-170s21c1
Sequence:CCGGATCTGCGGGACATACTCAAACCTCGAGGTTTGAGTATGTCCCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-4437s21c1
Sequence:CCGGTGCTCTACTGATTGTGGTAACCTCGAGGTTACCACAATCAGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-2937s21c1
Sequence:CCGGAGACTGGCCAGCACTAATTTGCTCGAGCAAATTAGTGCTGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-1089s21c1
Sequence:CCGGCAAGTTCTGGCAGATCTATATCTCGAGATATAGATCTGCCAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-305s21c1
Sequence:CCGGCAACGAACAAACCTGGTATACCTCGAGGTATACCAGGTTTGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181594
VALIDATED
EDC4 MISSION shRNA Lentiviral Transduction Particles
enhancer of mRNA decapping 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-2947s1c1
Sequence:CCGGGCACTAATTTGGCAGCAGCAACTCGAGTTGCTGCTGCCAAATTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-977s1c1
Sequence:CCGGGCCAAATCAAGCAAGGCTTTACTCGAGTAAAGCCTTGCTTGATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181594.2-3727s1c1
Sequence:CCGGCAGGAGTCAATCTTAGCACAACTCGAGTTGTGCTAAGATTGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-170s21c1
Sequence:CCGGATCTGCGGGACATACTCAAACCTCGAGGTTTGAGTATGTCCCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-4437s21c1
Sequence:CCGGTGCTCTACTGATTGTGGTAACCTCGAGGTTACCACAATCAGTAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-2937s21c1
Sequence:CCGGAGACTGGCCAGCACTAATTTGCTCGAGCAAATTAGTGCTGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-1089s21c1
Sequence:CCGGCAAGTTCTGGCAGATCTATATCTCGAGATATAGATCTGCCAGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181594.2-305s21c1
Sequence:CCGGCAACGAACAAACCTGGTATACCTCGAGGTATACCAGGTTTGTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014329
VALIDATED
EDC4 MISSION shRNA Bacterial Glycerol Stock
enhancer of mRNA decapping 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014329.3-3605s1c1
Sequence:CCGGGAATACTTGCAGCAGCTAGAACTCGAGTTCTAGCTGCTGCAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014329.3-571s1c1
Sequence:CCGGCAACCTGATTGCTGTGTCTAACTCGAGTTAGACACAGCAATCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-1299s1c1
Sequence:CCGGGAGAGTTAAAGATGTGGTGTACTCGAGTACACCACATCTTTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-3602s1c1
Sequence:CCGGCAGGAATACTTGCAGCAGCTACTCGAGTAGCTGCTGCAAGTATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-1548s1c1
Sequence:CCGGGCTTTGGTATCCAGGTTGTGACTCGAGTCACAACCTGGATACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014329
VALIDATED
EDC4 MISSION shRNA shRNA Plasmid DNA
enhancer of mRNA decapping 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014329.3-3605s1c1
Sequence:CCGGGAATACTTGCAGCAGCTAGAACTCGAGTTCTAGCTGCTGCAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014329.3-571s1c1
Sequence:CCGGCAACCTGATTGCTGTGTCTAACTCGAGTTAGACACAGCAATCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-1299s1c1
Sequence:CCGGGAGAGTTAAAGATGTGGTGTACTCGAGTACACCACATCTTTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-3602s1c1
Sequence:CCGGCAGGAATACTTGCAGCAGCTACTCGAGTAGCTGCTGCAAGTATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-1548s1c1
Sequence:CCGGGCTTTGGTATCCAGGTTGTGACTCGAGTCACAACCTGGATACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014329
VALIDATED
EDC4 MISSION shRNA Lentiviral Transduction Particles
enhancer of mRNA decapping 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014329.3-3605s1c1
Sequence:CCGGGAATACTTGCAGCAGCTAGAACTCGAGTTCTAGCTGCTGCAAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014329.3-571s1c1
Sequence:CCGGCAACCTGATTGCTGTGTCTAACTCGAGTTAGACACAGCAATCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-1299s1c1
Sequence:CCGGGAGAGTTAAAGATGTGGTGTACTCGAGTACACCACATCTTTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-3602s1c1
Sequence:CCGGCAGGAATACTTGCAGCAGCTACTCGAGTAGCTGCTGCAAGTATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014329.3-1548s1c1
Sequence:CCGGGCTTTGGTATCCAGGTTGTGACTCGAGTCACAACCTGGATACCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks