EMAIL THIS PAGE TO A FRIEND

EDDM3A

epididymal protein 3A

39 Gene Product Result for
Synonyms: EP3A FAM12A HE3-ALPHA HE3A HE3ALPHA
Species: Human EDDM3A(10876)
UniProtKB ID: Q14507, Q4KN33
Gene ID:
Human(10876) Summary: Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006683 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021761 MISSION® esiRNA esiRNA human FAM12A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006683 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134811 predicted 381
2 SASI_Hs01_00134812 predicted 633
3 SASI_Hs01_00134813 predicted 454
4 SASI_Hs01_00134815 predicted 608
5 SASI_Hs01_00134816 predicted 453
6 SASI_Hs01_00134817 predicted 470
7 SASI_Hs02_00342087 predicted 493
8 SASI_Hs02_00342088 predicted 282
9 SASI_Hs01_00134809 predicted 428
10 SASI_Hs01_00134810 predicted 387
11 SASI_Hs01_00134814 predicted 467
12 SASI_Hs01_00134818 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006683
EDDM3A MISSION shRNA Bacterial Glycerol Stock
epididymal protein 3A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006683.4-277s21c1
Sequence:CCGGTATGTTCATCTATAGCTTATGCTCGAGCATAAGCTATAGATGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006683.4-396s21c1
Sequence:CCGGACTGGGAGAAGTACAACAATACTCGAGTATTGTTGTACTTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-136s1c1
Sequence:CCGGCAGGCTGTGTGTATACAGTAACTCGAGTTACTGTATACACACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-488s1c1
Sequence:CCGGGAAGACCTGAGGATTATAGAACTCGAGTTCTATAATCCTCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006683.3-406s1c1
Sequence:CCGGGTACAACAATAGGTACACAGACTCGAGTCTGTGTACCTATTGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006683.3-651s1c1
Sequence:CCGGGAGTTTATGTACCTCGTGATTCTCGAGAATCACGAGGTACATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-337s1c1
Sequence:CCGGCGACCGATATAGAAATGCATACTCGAGTATGCATTTCTATATCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-493s1c1
Sequence:CCGGCCTGAGGATTATAGAACCTATCTCGAGATAGGTTCTATAATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006683
EDDM3A MISSION shRNA shRNA Plasmid DNA
epididymal protein 3A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006683.4-277s21c1
Sequence:CCGGTATGTTCATCTATAGCTTATGCTCGAGCATAAGCTATAGATGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006683.4-396s21c1
Sequence:CCGGACTGGGAGAAGTACAACAATACTCGAGTATTGTTGTACTTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-136s1c1
Sequence:CCGGCAGGCTGTGTGTATACAGTAACTCGAGTTACTGTATACACACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-488s1c1
Sequence:CCGGGAAGACCTGAGGATTATAGAACTCGAGTTCTATAATCCTCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006683.3-406s1c1
Sequence:CCGGGTACAACAATAGGTACACAGACTCGAGTCTGTGTACCTATTGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006683.3-651s1c1
Sequence:CCGGGAGTTTATGTACCTCGTGATTCTCGAGAATCACGAGGTACATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-337s1c1
Sequence:CCGGCGACCGATATAGAAATGCATACTCGAGTATGCATTTCTATATCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-493s1c1
Sequence:CCGGCCTGAGGATTATAGAACCTATCTCGAGATAGGTTCTATAATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006683
EDDM3A MISSION shRNA Lentiviral Transduction Particles
epididymal protein 3A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006683.4-277s21c1
Sequence:CCGGTATGTTCATCTATAGCTTATGCTCGAGCATAAGCTATAGATGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006683.4-396s21c1
Sequence:CCGGACTGGGAGAAGTACAACAATACTCGAGTATTGTTGTACTTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-136s1c1
Sequence:CCGGCAGGCTGTGTGTATACAGTAACTCGAGTTACTGTATACACACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-488s1c1
Sequence:CCGGGAAGACCTGAGGATTATAGAACTCGAGTTCTATAATCCTCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006683.3-406s1c1
Sequence:CCGGGTACAACAATAGGTACACAGACTCGAGTCTGTGTACCTATTGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006683.3-651s1c1
Sequence:CCGGGAGTTTATGTACCTCGTGATTCTCGAGAATCACGAGGTACATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-337s1c1
Sequence:CCGGCGACCGATATAGAAATGCATACTCGAGTATGCATTTCTATATCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006683.3-493s1c1
Sequence:CCGGCCTGAGGATTATAGAACCTATCTCGAGATAGGTTCTATAATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks