EMAIL THIS PAGE TO A FRIEND

EDDM3B

epididymal protein 3B

48 Gene Product Result for
Synonyms: EP3B FAM12B HE3-BETA HE3B
UniProtKB ID: P56851, A0PK89
Gene ID:
Human(64184) Summary: Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008]
Mouse(219026) epididymal protein 3B
Rat(290032) epididymal protein 3B
domestic cat(101091947) epididymal protein 3B
domestic guinea pig(100721442) epididymal protein 3B
sheep(101113073) epididymal protein 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_203508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_203508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_203508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022360 Rosetta Predictions human pricing
NM_178103 Rosetta Predictions rat pricing
NM_203508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216933 predicted 279
2 SASI_Hs02_00355655 predicted 347
3 SASI_Hs01_00216934 predicted 358
4 SASI_Hs01_00216935 predicted 278
5 SASI_Hs01_00216936 predicted 287
6 SASI_Hs01_00216937 predicted 200
7 SASI_Hs01_00216938 predicted 327
8 SASI_Hs01_00216939 predicted 438
9 SASI_Hs01_00216940 predicted 472
10 SASI_Hs01_00216942 predicted 382
11 SASI_Hs01_00216941 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065082 predicted 606
2 SASI_Rn01_00065083 predicted 386
3 SASI_Rn01_00065084 predicted 359
4 SASI_Rn01_00065085 predicted 210
5 SASI_Rn02_00269632 predicted 219
6 SASI_Rn01_00065086 predicted 586
7 SASI_Rn01_00065087 predicted 848
8 SASI_Rn01_00065088 predicted 754
9 SASI_Rn01_00065090 predicted 423
10 SASI_Rn01_00065091 predicted 491
11 SASI_Rn01_00065089 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096176 predicted 874
2 SASI_Mm01_00096177 predicted 274
3 SASI_Mm01_00096178 predicted 231
4 SASI_Mm01_00096179 predicted 218
5 SASI_Mm01_00096180 predicted 221
6 SASI_Mm01_00096181 predicted 207
7 SASI_Mm01_00096182 predicted 240
8 SASI_Mm01_00096183 predicted 953
9 SASI_Mm01_00096184 predicted 257
10 SASI_Mm01_00096185 predicted 857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022360
EDDM3B MISSION shRNA Bacterial Glycerol Stock
epididymal protein 3B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-384s1c1
Sequence:CCGGGTCCAGAATCCTCTCAAAGTACTCGAGTACTTTGAGAGGATTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-389s1c1
Sequence:CCGGGAATCCTCTCAAAGTACTCAACTCGAGTTGAGTACTTTGAGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-329s1c1
Sequence:CCGGGCATATATGCACTAGTGACAACTCGAGTTGTCACTAGTGCATATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-518s1c1
Sequence:CCGGGATGGTAGAACCTATCGGCAACTCGAGTTGCCGATAGGTTCTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022360.4-289s21c1
Sequence:CCGGGCTCTCACATGTTTATCTATACTCGAGTATAGATAAACATGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022360.4-573s21c1
Sequence:CCGGGAGTATTCAGTGCTTTCTAAGCTCGAGCTTAGAAAGCACTGAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022360
EDDM3B MISSION shRNA shRNA Plasmid DNA
epididymal protein 3B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-384s1c1
Sequence:CCGGGTCCAGAATCCTCTCAAAGTACTCGAGTACTTTGAGAGGATTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-389s1c1
Sequence:CCGGGAATCCTCTCAAAGTACTCAACTCGAGTTGAGTACTTTGAGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-329s1c1
Sequence:CCGGGCATATATGCACTAGTGACAACTCGAGTTGTCACTAGTGCATATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-518s1c1
Sequence:CCGGGATGGTAGAACCTATCGGCAACTCGAGTTGCCGATAGGTTCTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022360.4-289s21c1
Sequence:CCGGGCTCTCACATGTTTATCTATACTCGAGTATAGATAAACATGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022360.4-573s21c1
Sequence:CCGGGAGTATTCAGTGCTTTCTAAGCTCGAGCTTAGAAAGCACTGAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022360
EDDM3B MISSION shRNA Lentiviral Transduction Particles
epididymal protein 3B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-384s1c1
Sequence:CCGGGTCCAGAATCCTCTCAAAGTACTCGAGTACTTTGAGAGGATTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-389s1c1
Sequence:CCGGGAATCCTCTCAAAGTACTCAACTCGAGTTGAGTACTTTGAGAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-329s1c1
Sequence:CCGGGCATATATGCACTAGTGACAACTCGAGTTGTCACTAGTGCATATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022360.3-518s1c1
Sequence:CCGGGATGGTAGAACCTATCGGCAACTCGAGTTGCCGATAGGTTCTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022360.4-289s21c1
Sequence:CCGGGCTCTCACATGTTTATCTATACTCGAGTATAGATAAACATGTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022360.4-573s21c1
Sequence:CCGGGAGTATTCAGTGCTTTCTAAGCTCGAGCTTAGAAAGCACTGAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203508
EDDM3B MISSION shRNA Bacterial Glycerol Stock
epididymal protein 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203508.1-786s1c1
Sequence:CCGGGCTCTCTGCTACTGTGACAAACTCGAGTTTGTCACAGTAGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-220s1c1
Sequence:CCGGGCTCTCACACATGTTTGTTTACTCGAGTAAACAAACATGTGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-142s1c1
Sequence:CCGGCCATCACCTGAGTCCAAACAACTCGAGTTGTTTGGACTCAGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-419s1c1
Sequence:CCGGGATGGGTATGTCGACAGCATACTCGAGTATGCTGTCGACATACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-193s1c1
Sequence:CCGGCATGACAGATAAAGCCGTGAACTCGAGTTCACGGCTTTATCTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203508
EDDM3B MISSION shRNA shRNA Plasmid DNA
epididymal protein 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203508.1-786s1c1
Sequence:CCGGGCTCTCTGCTACTGTGACAAACTCGAGTTTGTCACAGTAGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-220s1c1
Sequence:CCGGGCTCTCACACATGTTTGTTTACTCGAGTAAACAAACATGTGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-142s1c1
Sequence:CCGGCCATCACCTGAGTCCAAACAACTCGAGTTGTTTGGACTCAGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-419s1c1
Sequence:CCGGGATGGGTATGTCGACAGCATACTCGAGTATGCTGTCGACATACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-193s1c1
Sequence:CCGGCATGACAGATAAAGCCGTGAACTCGAGTTCACGGCTTTATCTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203508
EDDM3B MISSION shRNA Lentiviral Transduction Particles
epididymal protein 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203508.1-786s1c1
Sequence:CCGGGCTCTCTGCTACTGTGACAAACTCGAGTTTGTCACAGTAGCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-220s1c1
Sequence:CCGGGCTCTCACACATGTTTGTTTACTCGAGTAAACAAACATGTGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-142s1c1
Sequence:CCGGCCATCACCTGAGTCCAAACAACTCGAGTTGTTTGGACTCAGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-419s1c1
Sequence:CCGGGATGGGTATGTCGACAGCATACTCGAGTATGCTGTCGACATACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203508.1-193s1c1
Sequence:CCGGCATGACAGATAAAGCCGTGAACTCGAGTTCACGGCTTTATCTGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks