EMAIL THIS PAGE TO A FRIEND

EDEM1

ER degradation enhancer, mannosidase alpha-like 1

152 Gene Product Result for
Synonyms: EDEM
UniProtKB ID: Q92611, A8K9C8
Gene ID:
Mouse(192193) ER degradation enhancer, mannosidase alpha-like 1
Rat(297504) ER degradation enhancer, mannosidase alpha-like 1
Zebrafish(394164) ER degradation enhancer, mannosidase alpha-like 1
dog(476547) ER degradation enhancer, mannosidase alpha-like 1
Horse(100059536) ER degradation enhancer, mannosidase alpha-like 1
cow(511008) ER degradation enhancer, mannosidase alpha-like 1
domestic cat(101089086) ER degradation enhancer, mannosidase alpha-like 1
fruit fly(31154) CG3810 gene product from transcript CG3810-RE
chicken(416110) ER degradation enhancer, mannosidase alpha-like 1
sheep(101103353) ER degradation enhancer, mannosidase alpha-like 1
domestic guinea pig(100714413) ER degradation enhancer, mannosidase alpha-like 1
naked mole-rat(101709291) ER degradation enhancer, mannosidase alpha-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014674 Rosetta Predictions human pricing
XM_001075914 Rosetta Predictions rat pricing
XM_001075943 Rosetta Predictions rat pricing
XM_238366 Rosetta Predictions rat pricing
NM_138677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189958 predicted 1574
2 SASI_Hs01_00189959 predicted 905
3 SASI_Hs02_00346026 predicted 1791
4 SASI_Hs01_00189960 predicted 718
5 SASI_Hs01_00189961 predicted 666
6 SASI_Hs01_00189962 predicted 1536
7 SASI_Hs01_00189964 predicted 683
8 SASI_Hs01_00189965 predicted 1980
9 SASI_Hs01_00189967 predicted 801
10 SASI_Hs02_00346027 predicted 1216
11 SASI_Hs01_00189963 predicted 601
12 SASI_Hs01_00189966 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351479 predicted 1504
2 SASI_Rn02_00351480 predicted 1082
3 SASI_Rn02_00351481 predicted 722
4 SASI_Rn02_00351482 predicted 1224
5 SASI_Rn02_00351483 predicted 630
6 SASI_Rn02_00351484 predicted 804
7 SASI_Rn02_00351485 predicted 574
8 SASI_Rn02_00351486 predicted 624
9 SASI_Rn02_00351487 predicted 1679
10 SASI_Rn02_00351488 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351579 predicted 1532
2 SASI_Rn02_00351580 predicted 1080
3 SASI_Rn02_00351581 predicted 720
4 SASI_Rn02_00351582 predicted 1225
5 SASI_Rn02_00351583 predicted 638
6 SASI_Rn02_00351584 predicted 804
7 SASI_Rn02_00351585 predicted 571
8 SASI_Rn02_00351586 predicted 618
9 SASI_Rn02_00351587 predicted 1711
10 SASI_Rn02_00351588 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391326 predicted 1534
2 SASI_Rn02_00391327 predicted 1081
3 SASI_Rn02_00391328 predicted 725
4 SASI_Rn02_00391329 predicted 1223
5 SASI_Rn02_00391330 predicted 631
6 SASI_Rn02_00391331 predicted 809
7 SASI_Rn02_00391332 predicted 577
8 SASI_Rn02_00391333 predicted 619
9 SASI_Rn02_00391334 predicted 1714
10 SASI_Rn02_00391335 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089821 predicted 1245
2 SASI_Mm01_00089822 predicted 1599
3 SASI_Mm01_00089823 predicted 1101
4 SASI_Mm01_00089824 predicted 827
5 SASI_Mm01_00089825 predicted 1958
6 SASI_Mm01_00089826 predicted 658
7 SASI_Mm01_00089827 predicted 1660
8 SASI_Mm01_00089828 predicted 1987
9 SASI_Mm01_00089830 predicted 1738
10 SASI_Mm02_00339756 predicted 2138
11 SASI_Mm01_00089829 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014674
VALIDATED
EDEM1 MISSION shRNA Bacterial Glycerol Stock
ER degradation enhancer, mannosidase alpha-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014674.2-5701s21c1
Sequence:CCGGCGCTTGAATCTGGACGTGAATCTCGAGATTCACGTCCAGATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-639s21c1
Sequence:CCGGCCCTTCAAATCTGAACATCAACTCGAGTTGATGTTCAGATTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-657s21c1
Sequence:CCGGCAATGATGTACTAGGGAACTACTCGAGTAGTTCCCTAGTACATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-2070s21c1
Sequence:CCGGCATGCGACAGATTGACCAGATCTCGAGATCTGGTCAATCTGTCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014674.2-5066s21c1
Sequence:CCGGGCTGGAACTTACTCATTGTAACTCGAGTTACAATGAGTAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-5628s1c1
Sequence:CCGGCGCTTGAATCTGGACGTGAATCTCGAGATTCACGTCCAGATTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-4993s1c1
Sequence:CCGGGCTGGAACTTACTCATTGTAACTCGAGTTACAATGAGTAAGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-583s1c1
Sequence:CCGGCAATGATGTACTAGGGAACTACTCGAGTAGTTCCCTAGTACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-565s1c1
Sequence:CCGGCCCTTCAAATCTGAACATCAACTCGAGTTGATGTTCAGATTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-1996s1c1
Sequence:CCGGCATGCGACAGATTGACCAGATCTCGAGATCTGGTCAATCTGTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014674
VALIDATED
EDEM1 MISSION shRNA shRNA Plasmid DNA
ER degradation enhancer, mannosidase alpha-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014674.2-5701s21c1
Sequence:CCGGCGCTTGAATCTGGACGTGAATCTCGAGATTCACGTCCAGATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-639s21c1
Sequence:CCGGCCCTTCAAATCTGAACATCAACTCGAGTTGATGTTCAGATTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-657s21c1
Sequence:CCGGCAATGATGTACTAGGGAACTACTCGAGTAGTTCCCTAGTACATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-2070s21c1
Sequence:CCGGCATGCGACAGATTGACCAGATCTCGAGATCTGGTCAATCTGTCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014674.2-5066s21c1
Sequence:CCGGGCTGGAACTTACTCATTGTAACTCGAGTTACAATGAGTAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-5628s1c1
Sequence:CCGGCGCTTGAATCTGGACGTGAATCTCGAGATTCACGTCCAGATTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-4993s1c1
Sequence:CCGGGCTGGAACTTACTCATTGTAACTCGAGTTACAATGAGTAAGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-583s1c1
Sequence:CCGGCAATGATGTACTAGGGAACTACTCGAGTAGTTCCCTAGTACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-565s1c1
Sequence:CCGGCCCTTCAAATCTGAACATCAACTCGAGTTGATGTTCAGATTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-1996s1c1
Sequence:CCGGCATGCGACAGATTGACCAGATCTCGAGATCTGGTCAATCTGTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014674
VALIDATED
EDEM1 MISSION shRNA Lentiviral Transduction Particles
ER degradation enhancer, mannosidase alpha-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014674.2-5701s21c1
Sequence:CCGGCGCTTGAATCTGGACGTGAATCTCGAGATTCACGTCCAGATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-639s21c1
Sequence:CCGGCCCTTCAAATCTGAACATCAACTCGAGTTGATGTTCAGATTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-657s21c1
Sequence:CCGGCAATGATGTACTAGGGAACTACTCGAGTAGTTCCCTAGTACATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014674.2-2070s21c1
Sequence:CCGGCATGCGACAGATTGACCAGATCTCGAGATCTGGTCAATCTGTCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014674.2-5066s21c1
Sequence:CCGGGCTGGAACTTACTCATTGTAACTCGAGTTACAATGAGTAAGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-5628s1c1
Sequence:CCGGCGCTTGAATCTGGACGTGAATCTCGAGATTCACGTCCAGATTCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150647    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-4993s1c1
Sequence:CCGGGCTGGAACTTACTCATTGTAACTCGAGTTACAATGAGTAAGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-583s1c1
Sequence:CCGGCAATGATGTACTAGGGAACTACTCGAGTAGTTCCCTAGTACATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-565s1c1
Sequence:CCGGCCCTTCAAATCTGAACATCAACTCGAGTTGATGTTCAGATTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014674.1-1996s1c1
Sequence:CCGGCATGCGACAGATTGACCAGATCTCGAGATCTGGTCAATCTGTCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138677
VALIDATED
EDEM1 MISSION shRNA Bacterial Glycerol Stock
ER degradation enhancer, mannosidase alpha-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-1827s21c1
Sequence:CCGGCCATATCATATCTGTGGACAACTCGAGTTGTCCACAGATATGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-2004s21c1
Sequence:CCGGGCCCTTAAAGAGCATCTACATCTCGAGATGTAGATGCTCTTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-650s21c1
Sequence:CCGGCCTTGGATACATTGGCAATAACTCGAGTTATTGCCAATGTATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-1102s21c1
Sequence:CCGGCGGAGCAACGATACAGGATTACTCGAGTAATCCTGTATCGTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138677.1-1993s1c1
Sequence:CCGGGCCCTTAAAGAGCATCTACATCTCGAGATGTAGATGCTCTTTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-581s1c1
Sequence:CCGGCCTTCCAATCTGAACATCAATCTCGAGATTGATGTTCAGATTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-639s1c1
Sequence:CCGGCCTTGGATACATTGGCAATAACTCGAGTTATTGCCAATGTATCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-1091s1c1
Sequence:CCGGCGGAGCAACGATACAGGATTACTCGAGTAATCCTGTATCGTTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138677
VALIDATED
EDEM1 MISSION shRNA shRNA Plasmid DNA
ER degradation enhancer, mannosidase alpha-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-1827s21c1
Sequence:CCGGCCATATCATATCTGTGGACAACTCGAGTTGTCCACAGATATGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-2004s21c1
Sequence:CCGGGCCCTTAAAGAGCATCTACATCTCGAGATGTAGATGCTCTTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-650s21c1
Sequence:CCGGCCTTGGATACATTGGCAATAACTCGAGTTATTGCCAATGTATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-1102s21c1
Sequence:CCGGCGGAGCAACGATACAGGATTACTCGAGTAATCCTGTATCGTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138677.1-1993s1c1
Sequence:CCGGGCCCTTAAAGAGCATCTACATCTCGAGATGTAGATGCTCTTTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-581s1c1
Sequence:CCGGCCTTCCAATCTGAACATCAATCTCGAGATTGATGTTCAGATTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-639s1c1
Sequence:CCGGCCTTGGATACATTGGCAATAACTCGAGTTATTGCCAATGTATCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-1091s1c1
Sequence:CCGGCGGAGCAACGATACAGGATTACTCGAGTAATCCTGTATCGTTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138677
VALIDATED
EDEM1 MISSION shRNA Lentiviral Transduction Particles
ER degradation enhancer, mannosidase alpha-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-1827s21c1
Sequence:CCGGCCATATCATATCTGTGGACAACTCGAGTTGTCCACAGATATGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-2004s21c1
Sequence:CCGGGCCCTTAAAGAGCATCTACATCTCGAGATGTAGATGCTCTTTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-650s21c1
Sequence:CCGGCCTTGGATACATTGGCAATAACTCGAGTTATTGCCAATGTATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138677.2-1102s21c1
Sequence:CCGGCGGAGCAACGATACAGGATTACTCGAGTAATCCTGTATCGTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138677.1-1993s1c1
Sequence:CCGGGCCCTTAAAGAGCATCTACATCTCGAGATGTAGATGCTCTTTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-581s1c1
Sequence:CCGGCCTTCCAATCTGAACATCAATCTCGAGATTGATGTTCAGATTGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-639s1c1
Sequence:CCGGCCTTGGATACATTGGCAATAACTCGAGTTATTGCCAATGTATCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138677.1-1091s1c1
Sequence:CCGGCGGAGCAACGATACAGGATTACTCGAGTAATCCTGTATCGTTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks