EMAIL THIS PAGE TO A FRIEND

EDEM2

ER degradation enhancer, mannosidase alpha-like 2

49 Gene Product Result for
Synonyms: C20orf31 C20orf49 bA4204.1
Gene ID:
Human(55741) Summary: In the endoplasmic reticulum (ER), misfolded proteins are retrotranslocated to the cytosol and degraded by the proteasome in a process known as ER-associated degradation (ERAD). EDEM2 belongs to a family of proteins involved in ERAD of glycoproteins (Mast et al., 2005 [PubMed 15537790]
Mouse(108687) ER degradation enhancer, mannosidase alpha-like 2
Rat(296304) ER degradation enhancer, mannosidase alpha-like 2
naked mole-rat(101700166) ER degradation enhancer, mannosidase alpha-like 2
domestic guinea pig(100714018) ER degradation enhancer, mannosidase alpha-like 2
sheep(101115389) ER degradation enhancer, mannosidase alpha-like 2
Domestic Rabbit(100344900) ER degradation enhancer, mannosidase alpha-like 2
Zebrafish(402801) ER degradation enhancer, mannosidase alpha-like 2
cow(513253) ER degradation enhancer, mannosidase alpha-like 2
Horse(100054608) ER degradation enhancer, mannosidase alpha-like 2
domestic cat(101083162) ER degradation enhancer, mannosidase alpha-like 2
dog(477209) ER degradation enhancer, mannosidase alpha-like 2
chicken(770034) ER degradation enhancer, mannosidase alpha-like 2
fruit fly(34714) CG5682 gene product from transcript CG5682-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018217 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018217 Rosetta Predictions human pricing
NM_001004230 Rosetta Predictions rat pricing
NM_145537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192739 predicted 345
2 SASI_Hs01_00192740 predicted 1409
3 SASI_Hs01_00192741 predicted 1585
4 SASI_Hs01_00192742 predicted 945
5 SASI_Hs01_00192743 predicted 1304
6 SASI_Hs01_00192744 predicted 1603
7 SASI_Hs01_00192745 predicted 854
8 SASI_Hs02_00351526 predicted 461
9 SASI_Hs01_00192746 predicted 1097
10 SASI_Hs01_00192747 predicted 436
11 SASI_Hs01_00192748 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045529 predicted 1465
2 SASI_Rn01_00045530 predicted 370
3 SASI_Rn01_00045531 predicted 923
4 SASI_Rn01_00045532 predicted 329
5 SASI_Rn01_00045533 predicted 1060
6 SASI_Rn01_00045534 predicted 1397
7 SASI_Rn01_00045535 predicted 1386
8 SASI_Rn01_00045536 predicted 888
9 SASI_Rn01_00045537 predicted 1527
10 SASI_Rn01_00045538 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162557 predicted 515
2 SASI_Mm01_00162558 predicted 1334
3 SASI_Mm01_00162559 predicted 903
4 SASI_Mm01_00162560 predicted 315
5 SASI_Mm02_00341018 predicted 872
6 SASI_Mm01_00162561 predicted 1448
7 SASI_Mm01_00162563 predicted 357
8 SASI_Mm01_00162564 predicted 1021
9 SASI_Mm01_00162565 predicted 1346
10 SASI_Mm01_00162566 predicted 1266
11 SASI_Mm01_00162562 predicted 1382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145537
EDEM2 MISSION shRNA Bacterial Glycerol Stock
ER degradation enhancer, mannosidase alpha-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1336s1c1
Sequence:CCGGCCTGGCTGAAACTGTGAAATACTCGAGTATTTCACAGTTTCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1375s1c1
Sequence:CCGGCCCAAACAACTTCATCCACAACTCGAGTTGTGGATGAAGTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-911s1c1
Sequence:CCGGCGGAATTACACGCACTTCGATCTCGAGATCGAAGTGCGTGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1369s1c1
Sequence:CCGGGTTCCACCCAAACAACTTCATCTCGAGATGAAGTTGTTTGGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1093s1c1
Sequence:CCGGGCTGCCAGAATTCTACAACATCTCGAGATGTTGTAGAATTCTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-1254s21c1
Sequence:CCGGGCTCATCGAGAGCGCAATGTACTCGAGTACATTGCGCTCTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145537.2-2074s21c1
Sequence:CCGGGAGATGTCACCACCGTTTATTCTCGAGAATAAACGGTGGTGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-1865s21c1
Sequence:CCGGCCTCATAGCCACTGGATAATTCTCGAGAATTATCCAGTGGCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-724s21c1
Sequence:CCGGGGGACCTTCATTGTGGAATTTCTCGAGAAATTCCACAATGAAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-471s21c1
Sequence:CCGGGAACGCCTCTGTGTTCGAAACCTCGAGGTTTCGAACACAGAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145537
EDEM2 MISSION shRNA shRNA Plasmid DNA
ER degradation enhancer, mannosidase alpha-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1336s1c1
Sequence:CCGGCCTGGCTGAAACTGTGAAATACTCGAGTATTTCACAGTTTCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1375s1c1
Sequence:CCGGCCCAAACAACTTCATCCACAACTCGAGTTGTGGATGAAGTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-911s1c1
Sequence:CCGGCGGAATTACACGCACTTCGATCTCGAGATCGAAGTGCGTGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1369s1c1
Sequence:CCGGGTTCCACCCAAACAACTTCATCTCGAGATGAAGTTGTTTGGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1093s1c1
Sequence:CCGGGCTGCCAGAATTCTACAACATCTCGAGATGTTGTAGAATTCTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-1254s21c1
Sequence:CCGGGCTCATCGAGAGCGCAATGTACTCGAGTACATTGCGCTCTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145537.2-2074s21c1
Sequence:CCGGGAGATGTCACCACCGTTTATTCTCGAGAATAAACGGTGGTGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-1865s21c1
Sequence:CCGGCCTCATAGCCACTGGATAATTCTCGAGAATTATCCAGTGGCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-724s21c1
Sequence:CCGGGGGACCTTCATTGTGGAATTTCTCGAGAAATTCCACAATGAAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-471s21c1
Sequence:CCGGGAACGCCTCTGTGTTCGAAACCTCGAGGTTTCGAACACAGAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145537
EDEM2 MISSION shRNA Lentiviral Transduction Particles
ER degradation enhancer, mannosidase alpha-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1336s1c1
Sequence:CCGGCCTGGCTGAAACTGTGAAATACTCGAGTATTTCACAGTTTCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1375s1c1
Sequence:CCGGCCCAAACAACTTCATCCACAACTCGAGTTGTGGATGAAGTTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-911s1c1
Sequence:CCGGCGGAATTACACGCACTTCGATCTCGAGATCGAAGTGCGTGTAATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1369s1c1
Sequence:CCGGGTTCCACCCAAACAACTTCATCTCGAGATGAAGTTGTTTGGGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145537.1-1093s1c1
Sequence:CCGGGCTGCCAGAATTCTACAACATCTCGAGATGTTGTAGAATTCTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-1254s21c1
Sequence:CCGGGCTCATCGAGAGCGCAATGTACTCGAGTACATTGCGCTCTCGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145537.2-2074s21c1
Sequence:CCGGGAGATGTCACCACCGTTTATTCTCGAGAATAAACGGTGGTGACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-1865s21c1
Sequence:CCGGCCTCATAGCCACTGGATAATTCTCGAGAATTATCCAGTGGCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-724s21c1
Sequence:CCGGGGGACCTTCATTGTGGAATTTCTCGAGAAATTCCACAATGAAGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145537.2-471s21c1
Sequence:CCGGGAACGCCTCTGTGTTCGAAACCTCGAGGTTTCGAACACAGAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018217
VALIDATED
EDEM2 MISSION shRNA Bacterial Glycerol Stock
ER degradation enhancer, mannosidase alpha-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-892s1c1
Sequence:CCGGGCTTCAGGATAAGAAGCTCATCTCGAGATGAGCTTCTTATCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-431s1c1
Sequence:CCGGGAAACAAACATTCGAGTGGTACTCGAGTACCACTCGAATGTTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-1126s1c1
Sequence:CCGGGCTCCCGGAATTCTACAACATCTCGAGATGTTGTAGAATTCCGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018217.1-922s1c1
Sequence:CCGGCCTAGAGTATAACAAAGCCATCTCGAGATGGCTTTGTTATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018217.1-595s1c1
Sequence:CCGGGCCATATGGAACAGTGAACTTCTCGAGAAGTTCACTGTTCCATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-613s21c1
Sequence:CCGGGCCATATGGAACAGTGAACTTCTCGAGAAGTTCACTGTTCCATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-940s21c1
Sequence:CCGGCCTAGAGTATAACAAAGCCATCTCGAGATGGCTTTGTTATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-1203s21c1
Sequence:CCGGCACTTCGGCCAGAACTTATTGCTCGAGCAATAAGTTCTGGCCGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-1624s21c1
Sequence:CCGGCAAACGGAGCAGGTCGAAATTCTCGAGAATTTCGACCTGCTCCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018217
VALIDATED
EDEM2 MISSION shRNA shRNA Plasmid DNA
ER degradation enhancer, mannosidase alpha-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-892s1c1
Sequence:CCGGGCTTCAGGATAAGAAGCTCATCTCGAGATGAGCTTCTTATCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-431s1c1
Sequence:CCGGGAAACAAACATTCGAGTGGTACTCGAGTACCACTCGAATGTTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-1126s1c1
Sequence:CCGGGCTCCCGGAATTCTACAACATCTCGAGATGTTGTAGAATTCCGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018217.1-922s1c1
Sequence:CCGGCCTAGAGTATAACAAAGCCATCTCGAGATGGCTTTGTTATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018217.1-595s1c1
Sequence:CCGGGCCATATGGAACAGTGAACTTCTCGAGAAGTTCACTGTTCCATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-613s21c1
Sequence:CCGGGCCATATGGAACAGTGAACTTCTCGAGAAGTTCACTGTTCCATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-940s21c1
Sequence:CCGGCCTAGAGTATAACAAAGCCATCTCGAGATGGCTTTGTTATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-1203s21c1
Sequence:CCGGCACTTCGGCCAGAACTTATTGCTCGAGCAATAAGTTCTGGCCGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-1624s21c1
Sequence:CCGGCAAACGGAGCAGGTCGAAATTCTCGAGAATTTCGACCTGCTCCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018217
VALIDATED
EDEM2 MISSION shRNA Lentiviral Transduction Particles
ER degradation enhancer, mannosidase alpha-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-892s1c1
Sequence:CCGGGCTTCAGGATAAGAAGCTCATCTCGAGATGAGCTTCTTATCCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-431s1c1
Sequence:CCGGGAAACAAACATTCGAGTGGTACTCGAGTACCACTCGAATGTTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018217.1-1126s1c1
Sequence:CCGGGCTCCCGGAATTCTACAACATCTCGAGATGTTGTAGAATTCCGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018217.1-922s1c1
Sequence:CCGGCCTAGAGTATAACAAAGCCATCTCGAGATGGCTTTGTTATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018217.1-595s1c1
Sequence:CCGGGCCATATGGAACAGTGAACTTCTCGAGAAGTTCACTGTTCCATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-613s21c1
Sequence:CCGGGCCATATGGAACAGTGAACTTCTCGAGAAGTTCACTGTTCCATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-940s21c1
Sequence:CCGGCCTAGAGTATAACAAAGCCATCTCGAGATGGCTTTGTTATACTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-1203s21c1
Sequence:CCGGCACTTCGGCCAGAACTTATTGCTCGAGCAATAAGTTCTGGCCGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018217.2-1624s21c1
Sequence:CCGGCAAACGGAGCAGGTCGAAATTCTCGAGAATTTCGACCTGCTCCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks