EMAIL THIS PAGE TO A FRIEND

EDEM3

ER degradation enhancer, mannosidase alpha-like 3

Synonyms: C1orf22
UniProtKB ID: Q9BZQ6, B2RCH6, Q0VGM5, Q5TEZ0, Q9HCW1, Q9UFV7
Gene ID:
Human(80267) Summary: Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]
Mouse(66967) ER degradation enhancer, mannosidase alpha-like 3
Rat(289085) ER degradation enhancer, mannosidase alpha-like 3
Zebrafish(559811) ER degradation enhancer, mannosidase alpha-like 3
domestic cat(101087192) ER degradation enhancer, mannosidase alpha-like 3
cow(519058) ER degradation enhancer, mannosidase alpha-like 3
Horse(100052092) ER degradation enhancer, mannosidase alpha-like 3
dog(480040) ER degradation enhancer, mannosidase alpha-like 3
chicken(424450) ER degradation enhancer, mannosidase alpha-like 3
sheep(101107978) ER degradation enhancer, mannosidase alpha-like 3
domestic guinea pig(100731767) ER degradation enhancer, mannosidase alpha-like 3
naked mole-rat(101710654) ER degradation enhancer, mannosidase alpha-like 3
295 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025191 Rosetta Predictions human pricing
XM_001070709 Rosetta Predictions rat pricing
XM_222721 Rosetta Predictions rat pricing
NM_001039644 Rosetta Predictions mouse pricing
XM_001003445 Rosetta Predictions mouse pricing
XM_001003454 Rosetta Predictions mouse pricing
XM_001003460 Rosetta Predictions mouse pricing
XM_001003470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038895 predicted 1207
2 SASI_Hs01_00038897 predicted 1871
3 SASI_Hs01_00038898 predicted 2977
4 SASI_Hs01_00038899 predicted 3091
5 SASI_Hs01_00038901 predicted 1050
6 SASI_Hs01_00038903 predicted 1816
7 SASI_Hs02_00357963 predicted 777
8 SASI_Hs02_00357964 predicted 488
9 SASI_Hs02_00357965 predicted 1882
10 SASI_Hs02_00357966 predicted 1160
11 SASI_Hs01_00038896 predicted 2536
12 SASI_Hs01_00038900 predicted 801
13 SASI_Hs01_00038902 predicted 1039
14 SASI_Hs01_00038904 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332509 predicted 1842
2 SASI_Rn02_00332510 predicted 1907
3 SASI_Rn02_00332511 predicted 1305
4 SASI_Rn02_00332512 predicted 1091
5 SASI_Rn02_00332513 predicted 1236
6 SASI_Rn02_00332514 predicted 1148
7 SASI_Rn02_00332515 predicted 878
8 SASI_Rn02_00332516 predicted 1918
9 SASI_Rn02_00332517 predicted 2105
10 SASI_Rn02_00332518 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380885 predicted 2358
2 SASI_Rn02_00380886 predicted 2011
3 SASI_Rn02_00380887 predicted 2304
4 SASI_Rn02_00380888 predicted 2139
5 SASI_Rn02_00380889 predicted 2105
6 SASI_Rn02_00380890 predicted 2141
7 SASI_Rn02_00380891 predicted 2101
8 SASI_Rn02_00380892 predicted 2307
9 SASI_Rn02_00380893 predicted 2372
10 SASI_Rn02_00380894 predicted 2397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104179 predicted 1072
2 SASI_Mm01_00104180 predicted 2905
3 SASI_Mm01_00104181 predicted 2865
4 SASI_Mm01_00104182 predicted 587
5 SASI_Mm01_00104183 predicted 984
6 SASI_Mm01_00104184 predicted 2798
7 SASI_Mm02_00290172 predicted 1673
8 SASI_Mm01_00104185 predicted 1939
9 SASI_Mm01_00104186 predicted 1424
10 SASI_Mm01_00104188 predicted 1848
11 SASI_Mm01_00104187 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210748 predicted 614
2 SASI_Mm01_00210749 predicted 536
3 SASI_Mm01_00210750 predicted 588
4 SASI_Mm01_00210751 predicted 591
5 SASI_Mm01_00210752 predicted 525
6 SASI_Mm01_00210753 predicted 502
7 SASI_Mm01_00210754 predicted 519
8 SASI_Mm01_00210755 predicted 506
9 SASI_Mm01_00210756 predicted 586
10 SASI_Mm01_00210757 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282460 predicted 622
2 SASI_Mm01_00282461 predicted 335
3 SASI_Mm01_00282462 predicted 1157
4 SASI_Mm01_00282463 predicted 590
5 SASI_Mm01_00282464 predicted 479
6 SASI_Mm01_00282465 predicted 526
7 SASI_Mm01_00282466 predicted 518
8 SASI_Mm01_00282467 predicted 510
9 SASI_Mm01_00282468 predicted 624
10 SASI_Mm01_00282469 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281067 predicted 621
2 SASI_Mm01_00281068 predicted 1155
3 SASI_Mm01_00281069 predicted 590
4 SASI_Mm01_00281070 predicted 515
5 SASI_Mm01_00281071 predicted 513
6 SASI_Mm01_00281072 predicted 2208
7 SASI_Mm01_00281073 predicted 628
8 SASI_Mm01_00281074 predicted 2199
9 SASI_Mm01_00281075 predicted 2210
10 SASI_Mm01_00281076 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221035 predicted 615
2 SASI_Mm01_00221036 predicted 2154
3 SASI_Mm01_00221037 predicted 2060
4 SASI_Mm01_00221038 predicted 590
5 SASI_Mm01_00221039 predicted 2229
6 SASI_Mm01_00221040 predicted 2206
7 SASI_Mm01_00221041 predicted 518
8 SASI_Mm01_00221042 predicted 504
9 SASI_Mm01_00221043 predicted 2267
10 SASI_Mm01_00221044 predicted 2250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039644
VALIDATED
EDEM3 MISSION shRNA Bacterial Glycerol Stock
ER degradation enhancer, mannosidase alpha-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-2249s21c1
Sequence:CCGGGCAAGCAGTAAACCATATAATCTCGAGATTATATGGTTTACTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039644.2-2912s21c1
Sequence:CCGGCAGCCTATAGACTCCATATTACTCGAGTAATATGGAGTCTATAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-529s21c1
Sequence:CCGGGGACACTCTTGTGGTATTAAACTCGAGTTTAATACCACAAGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-1316s21c1
Sequence:CCGGATGTTATACCAGGTGATTAAACTCGAGTTTAATCACCTGGTATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253061    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-4817s21c1
Sequence:CCGGAGTTATCAAAGCCGCATATTTCTCGAGAAATATGCGGCTTTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039644
VALIDATED
EDEM3 MISSION shRNA shRNA Plasmid DNA
ER degradation enhancer, mannosidase alpha-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-2249s21c1
Sequence:CCGGGCAAGCAGTAAACCATATAATCTCGAGATTATATGGTTTACTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039644.2-2912s21c1
Sequence:CCGGCAGCCTATAGACTCCATATTACTCGAGTAATATGGAGTCTATAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-529s21c1
Sequence:CCGGGGACACTCTTGTGGTATTAAACTCGAGTTTAATACCACAAGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-1316s21c1
Sequence:CCGGATGTTATACCAGGTGATTAAACTCGAGTTTAATCACCTGGTATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253061    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-4817s21c1
Sequence:CCGGAGTTATCAAAGCCGCATATTTCTCGAGAAATATGCGGCTTTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039644
VALIDATED
EDEM3 MISSION shRNA Lentiviral Transduction Particles
ER degradation enhancer, mannosidase alpha-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-2249s21c1
Sequence:CCGGGCAAGCAGTAAACCATATAATCTCGAGATTATATGGTTTACTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039644.2-2912s21c1
Sequence:CCGGCAGCCTATAGACTCCATATTACTCGAGTAATATGGAGTCTATAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-529s21c1
Sequence:CCGGGGACACTCTTGTGGTATTAAACTCGAGTTTAATACCACAAGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-1316s21c1
Sequence:CCGGATGTTATACCAGGTGATTAAACTCGAGTTTAATCACCTGGTATAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253061    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039644.2-4817s21c1
Sequence:CCGGAGTTATCAAAGCCGCATATTTCTCGAGAAATATGCGGCTTTGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025191
VALIDATED
EDEM3 MISSION shRNA Bacterial Glycerol Stock
ER degradation enhancer, mannosidase alpha-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-1080s1c1
Sequence:CCGGCCAGAGGCATTTACCACAGATCTCGAGATCTGTGGTAAATGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025191.2-2262s1c1
Sequence:CCGGCGGGAATATGAGGAGGTAGAACTCGAGTTCTACCTCCTCATATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025191.2-1773s1c1
Sequence:CCGGGCTAGTTCAATCGACGCTGAACTCGAGTTCAGCGTCGATTGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-2580s1c1
Sequence:CCGGCAGCTTCAAGAACAATCAGAACTCGAGTTCTGATTGTTCTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-6042s1c1
Sequence:CCGGCCCAATTTACAGCCGTATATTCTCGAGAATATACGGCTGTAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-4352s1c1
Sequence:CCGGGCATTCAGATATTCCAGGTAACTCGAGTTACCTGGAATATCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025191.2-1526s1c1
Sequence:CCGGCTTTCCTAATGACCCATTGTACTCGAGTACAATGGGTCATTAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-2502s1c1
Sequence:CCGGCCTTCTGAACAGACTTCTAATCTCGAGATTAGAAGTCTGTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-1023s1c1
Sequence:CCGGCCTGCTATTGAAACTCATGAACTCGAGTTCATGAGTTTCAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-144s1c1
Sequence:CCGGGCTGATGAACTCATGCCTTTACTCGAGTAAAGGCATGAGTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025191
VALIDATED
EDEM3 MISSION shRNA shRNA Plasmid DNA
ER degradation enhancer, mannosidase alpha-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-1080s1c1
Sequence:CCGGCCAGAGGCATTTACCACAGATCTCGAGATCTGTGGTAAATGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025191.2-2262s1c1
Sequence:CCGGCGGGAATATGAGGAGGTAGAACTCGAGTTCTACCTCCTCATATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025191.2-1773s1c1
Sequence:CCGGGCTAGTTCAATCGACGCTGAACTCGAGTTCAGCGTCGATTGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-2580s1c1
Sequence:CCGGCAGCTTCAAGAACAATCAGAACTCGAGTTCTGATTGTTCTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-6042s1c1
Sequence:CCGGCCCAATTTACAGCCGTATATTCTCGAGAATATACGGCTGTAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-4352s1c1
Sequence:CCGGGCATTCAGATATTCCAGGTAACTCGAGTTACCTGGAATATCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025191.2-1526s1c1
Sequence:CCGGCTTTCCTAATGACCCATTGTACTCGAGTACAATGGGTCATTAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-2502s1c1
Sequence:CCGGCCTTCTGAACAGACTTCTAATCTCGAGATTAGAAGTCTGTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-1023s1c1
Sequence:CCGGCCTGCTATTGAAACTCATGAACTCGAGTTCATGAGTTTCAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-144s1c1
Sequence:CCGGGCTGATGAACTCATGCCTTTACTCGAGTAAAGGCATGAGTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025191
VALIDATED
EDEM3 MISSION shRNA Lentiviral Transduction Particles
ER degradation enhancer, mannosidase alpha-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-1080s1c1
Sequence:CCGGCCAGAGGCATTTACCACAGATCTCGAGATCTGTGGTAAATGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025191.2-2262s1c1
Sequence:CCGGCGGGAATATGAGGAGGTAGAACTCGAGTTCTACCTCCTCATATTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025191.2-1773s1c1
Sequence:CCGGGCTAGTTCAATCGACGCTGAACTCGAGTTCAGCGTCGATTGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-2580s1c1
Sequence:CCGGCAGCTTCAAGAACAATCAGAACTCGAGTTCTGATTGTTCTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-6042s1c1
Sequence:CCGGCCCAATTTACAGCCGTATATTCTCGAGAATATACGGCTGTAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025191.2-4352s1c1
Sequence:CCGGGCATTCAGATATTCCAGGTAACTCGAGTTACCTGGAATATCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025191.2-1526s1c1
Sequence:CCGGCTTTCCTAATGACCCATTGTACTCGAGTACAATGGGTCATTAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-2502s1c1
Sequence:CCGGCCTTCTGAACAGACTTCTAATCTCGAGATTAGAAGTCTGTTCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-1023s1c1
Sequence:CCGGCCTGCTATTGAAACTCATGAACTCGAGTTCATGAGTTTCAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_025191.2-144s1c1
Sequence:CCGGGCTGATGAACTCATGCCTTTACTCGAGTAAAGGCATGAGTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks