EMAIL THIS PAGE TO A FRIEND

EDF1

endothelial differentiation-related factor 1

59 Gene Product Result for
Synonyms: EDF-1 MBF1
UniProtKB ID: O60869, Q5T5T2, Q9UIM1
Gene ID:
Human(8721) Summary: This gene encodes a protein that may regulate endothelial cell differentiation. It has been postulated that the protein functions as a bridging molecule that interconnects regulatory proteins and the basal transcriptional machinery, thereby modulating the transcription of genes involved in endothelial differentiation. This protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Two alternatively spliced transcripts which encode distinct proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(59022) endothelial differentiation-related factor 1
Rat(296570) endothelial differentiation-related factor 1
naked mole-rat(101709146) endothelial differentiation-related factor 1
domestic guinea pig(100733428) endothelial differentiation-related factor 1
sheep(101105488) endothelial differentiation-related factor 1
Zebrafish(793036) endothelial differentiation-related factor 1
cow(515380) endothelial differentiation-related factor 1
chicken(417286) endothelial differentiation-related factor 1
domestic cat(101096117) endothelial differentiation-related factor 1
dog(480674) endothelial differentiation-related factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108119 Anti-EDF1 antibody produced in rabbit affinity isolated antibody bovine, human, rat, pig, mouse, canine, horse, guinea pig
immunofluorescence, immunohistochemistry, western blot pricing
AV37729 Anti-EDF1 antibody produced in rabbit IgG fraction of antiserum mouse, human, canine, rat, bovine, guinea pig, pig
western blot pricing
SAB2100648 Anti-EDF1 antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, bovine, canine, mouse, rat, human, pig
western blot pricing
HPA035642 Anti-EDF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104652 Anti-EDF1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, mouse, horse, canine, bovine, zebrafish, rat, guinea pig, pig
western blot pricing
SAB1402430 Monoclonal Anti-EDF1 antibody produced in mouse clone 3E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003792 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003792 Rosetta Predictions human pricing
NM_153200 Rosetta Predictions human pricing
NM_001106557 Rosetta Predictions rat pricing
NM_021519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081669 predicted 356
2 SASI_Hs01_00081670 predicted 352
3 SASI_Hs01_00081671 predicted 395
4 SASI_Hs01_00081672 predicted 196
5 SASI_Hs01_00081673 predicted 361
6 SASI_Hs01_00081674 predicted 299
7 SASI_Hs01_00081676 predicted 228
8 SASI_Hs01_00081677 predicted 365
9 SASI_Hs01_00081678 predicted 197
10 SASI_Hs02_00336303 predicted 341
11 SASI_Hs01_00081675 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154041 predicted 193
2 SASI_Hs01_00154042 predicted 295
3 SASI_Hs01_00154043 predicted 301
4 SASI_Hs01_00154044 predicted 223
5 SASI_Hs01_00154045 predicted 203
6 SASI_Hs01_00154046 predicted 200
7 SASI_Hs01_00154047 predicted 248
8 SASI_Hs01_00154048 predicted 247
9 SASI_Hs01_00154049 predicted 295
10 SASI_Hs01_00154050 predicted 123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220128 predicted 397
2 SASI_Rn02_00220129 predicted 258
3 SASI_Rn02_00220130 predicted 368
4 SASI_Rn02_00220131 predicted 381
5 SASI_Rn02_00220132 predicted 240
6 SASI_Rn02_00220133 predicted 235
7 SASI_Rn02_00220134 predicted 238
8 SASI_Rn02_00220135 predicted 367
9 SASI_Rn02_00220136 predicted 369
10 SASI_Rn02_00220137 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031813 predicted 198
2 SASI_Mm01_00031814 predicted 272
3 SASI_Mm01_00031815 predicted 242
4 SASI_Mm01_00031816 predicted 380
5 SASI_Mm01_00031817 predicted 368
6 SASI_Mm01_00031818 predicted 327
7 SASI_Mm02_00326246 predicted 268
8 SASI_Mm01_00031819 predicted 355
9 SASI_Mm01_00031820 predicted 218
10 SASI_Mm01_00031821 predicted 259
11 SASI_Mm01_00031822 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021519
VALIDATED
EDF1 MISSION shRNA Bacterial Glycerol Stock
endothelial differentiation-related factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-392s1c1
Sequence:CCGGGCCATTCCGAATAACCAGGTTCTCGAGAACCTGGTTATTCGGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-160s1c1
Sequence:CCGGAGATGTGGAGACATCCAAGAACTCGAGTTCTTGGATGTCTCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-199s1c1
Sequence:CCGGCAAGCAGCATTCCATTACTAACTCGAGTTAGTAATGGAATGCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-358s1c1
Sequence:CCGGGCCGCAAGTCATCGCAGACTACTCGAGTAGTCTGCGATGACTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-349s1c1
Sequence:CCGGCAATGAGAAGCCGCAAGTCATCTCGAGATGACTTGCGGCTTCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-199s21c1
Sequence:CCGGCAAGCAGCATTCCATTACTAACTCGAGTTAGTAATGGAATGCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-146s21c1
Sequence:CCGGCAGCGACGAGGAGAAGATGTGCTCGAGCACATCTTCTCCTCGTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-160s21c1
Sequence:CCGGAGATGTGGAGACATCCAAGAACTCGAGTTCTTGGATGTCTCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-392s21c1
Sequence:CCGGGCCATTCCGAATAACCAGGTTCTCGAGAACCTGGTTATTCGGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-349s21c1
Sequence:CCGGCAATGAGAAGCCGCAAGTCATCTCGAGATGACTTGCGGCTTCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021519
VALIDATED
EDF1 MISSION shRNA shRNA Plasmid DNA
endothelial differentiation-related factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-392s1c1
Sequence:CCGGGCCATTCCGAATAACCAGGTTCTCGAGAACCTGGTTATTCGGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-160s1c1
Sequence:CCGGAGATGTGGAGACATCCAAGAACTCGAGTTCTTGGATGTCTCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-199s1c1
Sequence:CCGGCAAGCAGCATTCCATTACTAACTCGAGTTAGTAATGGAATGCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-358s1c1
Sequence:CCGGGCCGCAAGTCATCGCAGACTACTCGAGTAGTCTGCGATGACTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-349s1c1
Sequence:CCGGCAATGAGAAGCCGCAAGTCATCTCGAGATGACTTGCGGCTTCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-199s21c1
Sequence:CCGGCAAGCAGCATTCCATTACTAACTCGAGTTAGTAATGGAATGCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-146s21c1
Sequence:CCGGCAGCGACGAGGAGAAGATGTGCTCGAGCACATCTTCTCCTCGTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-160s21c1
Sequence:CCGGAGATGTGGAGACATCCAAGAACTCGAGTTCTTGGATGTCTCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-392s21c1
Sequence:CCGGGCCATTCCGAATAACCAGGTTCTCGAGAACCTGGTTATTCGGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-349s21c1
Sequence:CCGGCAATGAGAAGCCGCAAGTCATCTCGAGATGACTTGCGGCTTCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021519
VALIDATED
EDF1 MISSION shRNA Lentiviral Transduction Particles
endothelial differentiation-related factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-392s1c1
Sequence:CCGGGCCATTCCGAATAACCAGGTTCTCGAGAACCTGGTTATTCGGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-160s1c1
Sequence:CCGGAGATGTGGAGACATCCAAGAACTCGAGTTCTTGGATGTCTCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-199s1c1
Sequence:CCGGCAAGCAGCATTCCATTACTAACTCGAGTTAGTAATGGAATGCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-358s1c1
Sequence:CCGGGCCGCAAGTCATCGCAGACTACTCGAGTAGTCTGCGATGACTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021519.1-349s1c1
Sequence:CCGGCAATGAGAAGCCGCAAGTCATCTCGAGATGACTTGCGGCTTCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-199s21c1
Sequence:CCGGCAAGCAGCATTCCATTACTAACTCGAGTTAGTAATGGAATGCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-146s21c1
Sequence:CCGGCAGCGACGAGGAGAAGATGTGCTCGAGCACATCTTCTCCTCGTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-160s21c1
Sequence:CCGGAGATGTGGAGACATCCAAGAACTCGAGTTCTTGGATGTCTCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-392s21c1
Sequence:CCGGGCCATTCCGAATAACCAGGTTCTCGAGAACCTGGTTATTCGGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021519.1-349s21c1
Sequence:CCGGCAATGAGAAGCCGCAAGTCATCTCGAGATGACTTGCGGCTTCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003792
VALIDATED
EDF1 MISSION shRNA Bacterial Glycerol Stock
endothelial differentiation-related factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-484s1c1
Sequence:CCGGCCTCGAAATCAGTGCGCTCCACTCGAGTGGAGCGCACTGATTTCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-168s1c1
Sequence:CCGGGCCAGAACAAACAACATTCTACTCGAGTAGAATGTTGTTTGTTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-335s1c1
Sequence:CCGGCCACAGGTGATCGCGGACTATCTCGAGATAGTCCGCGATCACCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-94s1c1
Sequence:CCGGCAAATCCAAGCAGGCTATCTTCTCGAGAAGATAGCCTGCTTGGATTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-436s1c1
Sequence:CCGGCATTGGAAAGCCCATCGAGAACTCGAGTTCTCGATGGGCTTTCCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-94s21c1
Sequence:CCGGCAAATCCAAGCAGGCTATCTTCTCGAGAAGATAGCCTGCTTGGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-484s21c1
Sequence:CCGGCCTCGAAATCAGTGCGCTCCACTCGAGTGGAGCGCACTGATTTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-335s21c1
Sequence:CCGGCCACAGGTGATCGCGGACTATCTCGAGATAGTCCGCGATCACCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003792.2-168s21c1
Sequence:CCGGGCCAGAACAAACAACATTCTACTCGAGTAGAATGTTGTTTGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003792
VALIDATED
EDF1 MISSION shRNA shRNA Plasmid DNA
endothelial differentiation-related factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-484s1c1
Sequence:CCGGCCTCGAAATCAGTGCGCTCCACTCGAGTGGAGCGCACTGATTTCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-168s1c1
Sequence:CCGGGCCAGAACAAACAACATTCTACTCGAGTAGAATGTTGTTTGTTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-335s1c1
Sequence:CCGGCCACAGGTGATCGCGGACTATCTCGAGATAGTCCGCGATCACCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-94s1c1
Sequence:CCGGCAAATCCAAGCAGGCTATCTTCTCGAGAAGATAGCCTGCTTGGATTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-436s1c1
Sequence:CCGGCATTGGAAAGCCCATCGAGAACTCGAGTTCTCGATGGGCTTTCCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-94s21c1
Sequence:CCGGCAAATCCAAGCAGGCTATCTTCTCGAGAAGATAGCCTGCTTGGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-484s21c1
Sequence:CCGGCCTCGAAATCAGTGCGCTCCACTCGAGTGGAGCGCACTGATTTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-335s21c1
Sequence:CCGGCCACAGGTGATCGCGGACTATCTCGAGATAGTCCGCGATCACCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003792.2-168s21c1
Sequence:CCGGGCCAGAACAAACAACATTCTACTCGAGTAGAATGTTGTTTGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003792
VALIDATED
EDF1 MISSION shRNA Lentiviral Transduction Particles
endothelial differentiation-related factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-484s1c1
Sequence:CCGGCCTCGAAATCAGTGCGCTCCACTCGAGTGGAGCGCACTGATTTCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-168s1c1
Sequence:CCGGGCCAGAACAAACAACATTCTACTCGAGTAGAATGTTGTTTGTTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-335s1c1
Sequence:CCGGCCACAGGTGATCGCGGACTATCTCGAGATAGTCCGCGATCACCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-94s1c1
Sequence:CCGGCAAATCCAAGCAGGCTATCTTCTCGAGAAGATAGCCTGCTTGGATTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003792.2-436s1c1
Sequence:CCGGCATTGGAAAGCCCATCGAGAACTCGAGTTCTCGATGGGCTTTCCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-94s21c1
Sequence:CCGGCAAATCCAAGCAGGCTATCTTCTCGAGAAGATAGCCTGCTTGGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-484s21c1
Sequence:CCGGCCTCGAAATCAGTGCGCTCCACTCGAGTGGAGCGCACTGATTTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003792.2-335s21c1
Sequence:CCGGCCACAGGTGATCGCGGACTATCTCGAGATAGTCCGCGATCACCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003792.2-168s21c1
Sequence:CCGGGCCAGAACAAACAACATTCTACTCGAGTAGAATGTTGTTTGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)